G24635 (e2f7,LOC107656240,LOC107707966,LOC107658780)


Basic Information

Item Value
gene id G24635
gene name e2f7,LOC107656240,LOC107707966,LOC107658780
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056702.1
NCBI id CM032071.1
chromosome length 29200999
location 379203 ~ 379444 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU36686
CGTGCATGCTCTGCATGTGGTGGGCGGCGTGCAGGCCGCTTCCTCCTCCCTGGTTCATCTGGAGATGGTAGCCCTGCTCGCGACCGGCCCGGTGGAGGTCCTGCAGGGTCTGAGGCAGCGCCGAGCGTCCGTGCCACACGTACAGGTTCTTAGCCATCCTGCTCACCAGCATCAGAGACTCCAGCACGTTCACGATGTCGTAGATCCGCCGCCGCTCAACGCCTGCCTCACAGAGACAGTCA

Function

symbol description
e2f7 Enables DNA binding activity and DNA-binding transcription factor activity. Involved in positive regulation of transcription by RNA polymerase II and sprouting angiogenesis. Acts upstream of or within lymphangiogenesis; motor neuron axon guidance; and negative regulation of transcription, DNA-templated. Predicted to be located in nucleus. Predicted to be part of RNA polymerase II transcription regulator complex. Is expressed in brain; caudal vein plexus; eye; and head. Orthologous to human E2F7 (E2F transcription factor 7).

NR:

description
PREDICTED: transcription factor E2F7

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU36686 True 242 lncRNA 0.64 1 379203 379444

Neighbor

gene id symbol gene type direction distance location
zdhhc17 zdhhc17,LOC107708015,LOC107658960,LOC107656450 coding upstream 18281 343592 ~ 360922 (+)
LOC122343357 LOC107658963,LOC107708011,LOC107555883 coding upstream 166044 205505 ~ 213159 (+)
glipr1a NA coding upstream 179667 195092 ~ 199536 (+)
frs2a frs2,frs2a,LOC107658966,LOC107590545,LOC107729158 coding upstream 271898 90208 ~ 107305 (+)
yeats4 yeats4,LOC107555875,LOC107590554,LOC106609801,LOC107717680 coding upstream 290051 87004 ~ 89152 (+)
LOC122342832 NA coding downstream 481152 860596 ~ 863551 (+)
LOC122342829 LOC107705336,LOC107583937,LOC107656238 coding downstream 487752 867196 ~ 888759 (+)
fgd4b LOC107658950,LOC107705337,LOC107656390,LOC107590534,LOC107584024 coding downstream 511253 890697 ~ 908324 (+)
nampt1 nampt,nampta,LOC107658946,LOC107705339,LOC107656408,LOC107718548,LOC102790888 coding downstream 538138 917582 ~ 931678 (+)
sypl1 sypl1,LOC107590538,LOC107658778,LOC107583939,LOC107656429,LOC107718552 coding downstream 554602 934046 ~ 937823 (+)
G24634 NA non-coding upstream 2995 375925 ~ 376208 (+)
G24633 NA non-coding upstream 4359 374558 ~ 374844 (+)
G24631 NA non-coding upstream 6350 372374 ~ 372853 (+)
G24628 NA non-coding upstream 16435 362442 ~ 362768 (+)
G24599 NA non-coding upstream 117239 261456 ~ 261964 (+)
G24638 e2f7,LOC107658780,LOC107707966,LOC107576736,LOC107576735,LOC107656240 non-coding downstream 1107 380551 ~ 383178 (+)
LOC122342795 NA non-coding downstream 7751 387195 ~ 388081 (+)
G24687 NA non-coding downstream 200665 580109 ~ 580350 (+)
G24746 NA non-coding downstream 227843 607287 ~ 607514 (+)
G24751 NA non-coding downstream 236156 615600 ~ 615856 (+)
G24632 LOC107584022 other upstream 5121 373527 ~ 374082 (+)
G24609 NA other upstream 84134 293235 ~ 295069 (+)
cmah cmah,LOC107555874,LOC107729160,LOC107656456,LOC107590555 other upstream 185020 184716 ~ 194183 (+)
G24555 cpsf6 other upstream 294241 83688 ~ 84962 (+)
gpr22a gpr22a,LOC107658958,LOC107583929,LOC107729153,LOC107708019,LOC107590528,LOC107656448 other downstream 54899 434343 ~ 439352 (+)
G24771 plekha5,LOC107584023,LOC107658747 other downstream 274648 654092 ~ 665530 (+)
LOC122342481 LOC107584054,LOC107658775,LOC107725972,LOC107711476,LOC107581286,LOC107656415,LOC107725915 other downstream 866134 1245578 ~ 1249169 (+)
ndufa5 ndufa5,LOC107725958,LOC107658774,LOC107579922 other downstream 908853 1288297 ~ 1291224 (+)
LOC122342419 coa6,LOC107726010,LOC107583951,LOC107658937 other downstream 950008 1329452 ~ 1331843 (+)

Expression


Co-expression Network