G28901


Basic Information

Item Value
gene id G28901
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056702.1
NCBI id CM032071.1
chromosome length 29200999
location 16057475 ~ 16057700 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU42863
ctcattaatagctgtaatttttaccctgcagaccataacactttttattctgctccatattctagtctgataggccttttctttcacctctttttctaatttccctttagtaaaaaatgttgcagcttgcctgttctgtaccgccattttatgctctttgtctgctctttcttcttctctcattatggcctttaatagttcccctttgttctcagtggaattgtcc

Function

GO:

id name namespace
GO:0009410 response to xenobiotic stimulus biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU42863 True 226 lncRNA 0.38 1 16057475 16057700

Neighbor

gene id symbol gene type direction distance location
LOC122342219 LOC107554691,LOC107656224 coding upstream 412601 15638512 ~ 15644874 (+)
nup50 nup50,LOC107699201,LOC107562145,LOC107687567,LOC107601009,LOC107719874 coding upstream 455469 15595661 ~ 15602006 (+)
LOC122343379 ppm1j,LOC107668166,LOC107708158 coding upstream 701920 15342262 ~ 15355555 (+)
creld2 LOC107730684,LOC107699369,LOC107601011 coding upstream 899841 15149133 ~ 15157634 (+)
LOC122342621 zbed4,LOC107744591,LOC107663563,LOC107563622 coding upstream 914064 15136921 ~ 15143411 (+)
LOC122342595 NA coding downstream 316876 16374576 ~ 16377941 (+)
LOC122342597 rab3ip,LOC107709967,LOC107689177,LOC107757202,LOC107675141,LOC107554773 coding downstream 320933 16378633 ~ 16398499 (+)
LOC122342594 LOC107709965,LOC107554744,LOC107700908,LOC107675140,LOC107569318,LOC107757199 coding downstream 340932 16398632 ~ 16427186 (+)
ptprb LOC107709971,LOC107685369,LOC107738449,LOC107575178,LOC107562139 coding downstream 378691 16436391 ~ 16457297 (+)
LOC122342226 NA coding downstream 557645 16615345 ~ 16617218 (+)
G28896 NA non-coding upstream 128637 15928131 ~ 15928838 (+)
G28890 NA non-coding upstream 216809 15840202 ~ 15840666 (+)
G28889 NA non-coding upstream 302347 15754813 ~ 15755128 (+)
G28888 NA non-coding upstream 319713 15737468 ~ 15737762 (+)
G28882 NA non-coding upstream 331921 15725192 ~ 15725554 (+)
G28911 NA non-coding downstream 354317 16412017 ~ 16419965 (+)
G28912 NA non-coding downstream 354826 16412526 ~ 16420148 (+)
LOC122342600 NA non-coding downstream 399777 16457477 ~ 16461526 (+)
G28969 NA non-coding downstream 406745 16464445 ~ 16464690 (+)
G28985 NA non-coding downstream 417043 16474743 ~ 16475333 (+)
G28899 NA other upstream 71749 15985219 ~ 15985726 (+)
G28891 NA other upstream 215620 15841372 ~ 15841855 (+)
cdkn1d LOC107699204,LOC107719868,LOC107562144,LOC107601015,LOC107758204,LOC107687563 other upstream 402197 15565499 ~ 15655278 (+)
G28806 LOC107744205,LOC107601002,LOC107687568,LOC107699198 other upstream 501793 15439334 ~ 15555682 (+)
LOC122342869 NA other upstream 637172 15413147 ~ 15420303 (+)
G28982 NA other downstream 416198 16473898 ~ 16474381 (+)
atp5mj NA other downstream 980719 17038419 ~ 17040830 (+)
G29526 NA other downstream 2242715 18300415 ~ 18301189 (+)
G29545 NA other downstream 2378760 18436460 ~ 18461317 (+)
G29642 NA other downstream 2825479 18883179 ~ 18886402 (+)

Expression


Co-expression Network