G30005


Basic Information

Item Value
gene id G30005
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056702.1
NCBI id CM032071.1
chromosome length 29200999
location 20785309 ~ 20785530 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU44458
CGAGACGCCACTTCTCCCACGCGTCCATCGAATACCCGGCCGCCATCGTCCCGGCAGGACAATCGGGTTCCCCCGAACCCACGCTTCTCTTCGAGAAGATGGTGTCAATTGCGTTGAGAGACCAGTTGATCAAATCCATGTTTTCAGCTGGAGAGCAGGGCAGAGAGAGTCTCTCAAGTGGAGAAAAGTAGACACAAGACGAGACTAAGAAGCACAAGCAGG

Function

GO:

id name namespace
GO:0043254 regulation of protein-containing complex assembly biological_process
GO:0044085 cellular component biogenesis biological_process
GO:0044087 regulation of cellular component biogenesis biological_process
GO:0044089 positive regulation of cellular component biogenesis biological_process
GO:0051128 regulation of cellular component organization biological_process
GO:0051130 positive regulation of cellular component organization biological_process
GO:0022607 cellular component assembly biological_process
GO:0010638 positive regulation of organelle organization biological_process
GO:0065003 protein-containing complex assembly biological_process
GO:0065008 regulation of biological quality biological_process
GO:0008154 actin polymerization or depolymerization biological_process
GO:1902903 regulation of supramolecular fiber organization biological_process
GO:1902905 positive regulation of supramolecular fiber organization biological_process
GO:0090066 regulation of anatomical structure size biological_process
GO:0051493 regulation of cytoskeleton organization biological_process
GO:0051495 positive regulation of cytoskeleton organization biological_process
GO:0006996 organelle organization biological_process
GO:0031334 positive regulation of protein-containing complex assembly biological_process
GO:0032956 regulation of actin cytoskeleton organization biological_process
GO:0007010 cytoskeleton organization biological_process
GO:0043933 protein-containing complex subunit organization biological_process
GO:0007015 actin filament organization biological_process
GO:0032970 regulation of actin filament-based process biological_process
GO:0051258 protein polymerization biological_process
GO:0097435 supramolecular fiber organization biological_process
GO:0034314 Arp2/3 complex-mediated actin nucleation biological_process
GO:0030832 regulation of actin filament length biological_process
GO:0030833 regulation of actin filament polymerization biological_process
GO:0030838 positive regulation of actin filament polymerization biological_process
GO:0030029 actin filament-based process biological_process
GO:0033043 regulation of organelle organization biological_process
GO:0034622 cellular protein-containing complex assembly biological_process
GO:0030036 actin cytoskeleton organization biological_process
GO:0030041 actin filament polymerization biological_process
GO:0045010 actin nucleation biological_process
GO:0110053 regulation of actin filament organization biological_process
GO:0008064 regulation of actin polymerization or depolymerization biological_process
GO:0032535 regulation of cellular component size biological_process
GO:0032271 regulation of protein polymerization biological_process
GO:0032273 positive regulation of protein polymerization biological_process

KEGG:

id description
ko05130 Pathogenic Escherichia coli infection
ko05100 Bacterial invasion of epithelial cells

RNA

RNA id representative length rna type GC content exon number start site end site
TU44458 True 222 lncRNA 0.55 1 20785309 20785530

Neighbor

gene id symbol gene type direction distance location
LOC122342964 NA coding upstream 107400 20655215 ~ 20677909 (+)
LOC122343085 LOC107561645,LOC107566978,LOC107748257,LOC107741456 coding upstream 140517 20640142 ~ 20644792 (+)
LOC122342277 LOC107741474 coding upstream 146698 20633884 ~ 20638611 (+)
LOC122343005 NA coding upstream 226295 20543132 ~ 20559014 (+)
LOC122342276 NA coding upstream 269680 20505411 ~ 20515629 (+)
LOC122342951 NA coding downstream 4645 20790175 ~ 20800541 (+)
LOC122343111 NA coding downstream 116689 20902219 ~ 20906726 (+)
LOC122343116 NA coding downstream 132020 20917550 ~ 20918689 (+)
LOC122342280 NA coding downstream 135905 20921435 ~ 20929163 (+)
LOC122342283 NA coding downstream 232622 21018152 ~ 21020872 (+)
G29947 LOC107709565,LOC107727338,LOC107575420,LOC107569100 non-coding upstream 139774 20645257 ~ 20645535 (+)
G29945 NA non-coding upstream 153980 20630820 ~ 20631329 (+)
G29927 LOC107681551 non-coding upstream 287441 20497097 ~ 20497868 (+)
LOC122343178 NA non-coding upstream 322967 20459370 ~ 20462342 (+)
LOC122343162 LOC107575631,LOC107741456,LOC107667978,LOC107575420,LOC107741609,LOC107727338,LOC107575457,LOC107566978 non-coding upstream 342084 20440548 ~ 20443225 (+)
G30003 NA non-coding downstream 94919 20880449 ~ 20882908 (+)
G30024 NA non-coding downstream 124624 20910154 ~ 20975778 (+)
G30025 LOC107561645 non-coding downstream 127028 20912558 ~ 20934912 (+)
LOC122343171 NA non-coding downstream 185980 20971510 ~ 20972249 (+)
G30056 NA non-coding downstream 332131 21117661 ~ 21118522 (+)
G29961 NA other upstream 78463 20696672 ~ 20706846 (+)
G29921 NA other upstream 416493 20367675 ~ 20368816 (+)
LOC122342270 NA other upstream 438585 20344346 ~ 20346724 (+)
LOC122343063 NA other upstream 741856 20037933 ~ 20043453 (+)
G29835 NA other upstream 999181 19731262 ~ 19786128 (+)
G30058 NA other downstream 333032 21118562 ~ 21142831 (+)
LOC122342286 LOC107578117 other downstream 383663 21169193 ~ 21174340 (+)
LOC122342301 LOC107563870,LOC107718524,LOC107683800,LOC107564010,LOC107563545 other downstream 583113 21368643 ~ 21761181 (+)
G30119 NA other downstream 602663 21388193 ~ 21630120 (+)
G30115 NA other downstream 854010 21639540 ~ 21641756 (+)

Expression


Co-expression Network