G30628


Basic Information

Item Value
gene id G30628
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056702.1
NCBI id CM032071.1
chromosome length 29200999
location 23066254 ~ 23143079 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU45339
ATTAGTAGCATTAACAGAGGCCTGTAAAATCGCCGAAGGAAAAACAGTCACCATCTATATAGACTCGTTATGCCTTTTCAACATGTCATGACTTTTCGGCTCTATGGCGATGTAGGAAATTTCTAAAATCCGATGGTAAACCCATCCAAAATCATGACAAAATAGCAGCCTTGCTAGAAGCGATTTTGCTTCCAAGGTCGATTGCTATTTGCAAGTGCGTCGCGCATTCCAAGTTTAACGATTTTGT

Function

GO: NA

KEGG:

id description
ko00980 Metabolism of xenobiotics by cytochrome P450
ko00982 Drug metabolism - cytochrome P450

RNA

RNA id representative length rna type GC content exon number start site end site
TU45339 True 247 lncRNA 0.40 2 23066254 23143079

Neighbor

gene id symbol gene type direction distance location
LOC122342997 LOC107572920,LOC107713771,LOC107575181,LOC107684374,LOC107677802 coding upstream 317634 22739960 ~ 22748620 (+)
LOC122342996 LOC107572920,LOC107713771,LOC107575181,LOC107684374,LOC107677802 coding upstream 359760 22695800 ~ 22706494 (+)
LOC122343101 NA coding upstream 376575 22685702 ~ 22689679 (+)
LOC122342965 NA coding upstream 444368 22613115 ~ 22621886 (+)
LOC122343138 si:ch211-133h13.1,LOC107574515,LOC107574820 coding upstream 504491 22548617 ~ 22561763 (+)
LOC122343008 LOC107575457 coding downstream 25076 23168155 ~ 23183546 (+)
LOC122343131 NA coding downstream 83132 23226211 ~ 23229732 (+)
LOC122343152 NA coding downstream 208848 23351927 ~ 23375871 (+)
LOC122342330 LOC101883771,LOC101885620,LOC108191338 coding downstream 470399 23613478 ~ 23614930 (+)
LOC122342945 LOC107563545 coding downstream 490719 23633798 ~ 24144571 (+)
G30607 NA non-coding upstream 196551 22853481 ~ 22869703 (+)
G30609 NA non-coding upstream 204684 22858290 ~ 22861570 (+)
LOC122343204 NA non-coding upstream 514904 22550101 ~ 22551350 (+)
LOC122343169 NA non-coding upstream 522423 22542511 ~ 22543831 (+)
LOC122343193 NA non-coding upstream 524769 22540384 ~ 22541485 (+)
LOC122343191 NA non-coding downstream 44237 23187316 ~ 23193862 (+)
G30652 NA non-coding downstream 120518 23263597 ~ 23264466 (+)
G30653 NA non-coding downstream 121454 23264533 ~ 23264741 (+)
G30654 NA non-coding downstream 122787 23265866 ~ 23266302 (+)
G30658 NA non-coding downstream 131426 23274505 ~ 23282812 (+)
LOC122342317 NA other upstream 286115 22777983 ~ 22780139 (+)
LOC122343019 LOC107705900 other upstream 383542 22661826 ~ 22682712 (+)
LOC122342310 LOC107685875,LOC107671223,LOC107749047,LOC107728228,LOC107576424 other upstream 761106 22296897 ~ 22305148 (+)
G30218 LOC106676322,LOC106676931,LOC106676323,LOC107752219,LOC106675762,LOC106674878,LOC106676183 other upstream 834330 22231470 ~ 22231924 (+)
G30115 NA other upstream 1424498 21639540 ~ 21641756 (+)
G30632 NA other downstream 14480 23157559 ~ 23159756 (+)
LOC122342321 LOC107741609,LOC107575420,LOC107710255 other downstream 20616 23163695 ~ 23168007 (+)
LOC122342976 usp15,LOC107685889 other downstream 974210 24117289 ~ 24131487 (+)
LOC122342990 NA other downstream 989971 24133050 ~ 24141446 (+)
LOC122343028 pacsin2,LOC107725788,LOC107569113 other downstream 1311191 24454270 ~ 24466400 (+)

Expression


Co-expression Network