G31467 (zbtb22b,LOC107752533,LOC107665126,LOC107666316,LOC107549842,LOC107554346,LOC107753716)


Basic Information

Item Value
gene id G31467
gene name zbtb22b,LOC107752533,LOC107665126,LOC107666316,LOC107549842,LOC107554346,LOC107753716
gene type unknown
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056702.1
NCBI id CM032071.1
chromosome length 29200999
location 27379059 ~ 27382827 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU46463
AGAGCAGCTGTCTGGGATTTCTTAAAGGCAAAAGCAGACTCCAAACCCGATGTCAGTCCACCATTACGCTCGGCATTCCCGGACGCTGGGAAACGTCGCTCTATCGCGATGAAAAGCCCTCTTTTGAGTGCCTGACGGACACATTTAAATCGGAATGCAGTCGGCCGCGGCGGAGCAAGGCTATGGTGACTCTGCAGGTTCGGTGGTGCAGGTGTGCTTCCCCAGCGTGCAGGCCTCGGTGCTGGACAGCCTGAACCGGCAGCGTGAAGACGGCCATCTCTGTGACCTCTCCATCCACGTTCAGGGCCAGGTGTTCAAGGCCCATCGGTGTGTGCTGGCTGCGTCCTCACCTTACTTCCACGACCAGGTGCTGCTGAAGAACATGTCCACCGTCACCATCCCGGCCGTCATGGACCCGCTGGCCT

Function

symbol description
zbtb22b Predicted to enable RNA polymerase II transcription regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to be active in nucleus. Orthologous to human ZBTB22 (zinc finger and BTB domain containing 22).

NR:

description
PREDICTED: zinc finger and BTB domain-containing protein 22-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU46463 True 425 TUCP 0.59 3 27379059 27382827

Neighbor

gene id symbol gene type direction distance location
LOC122342367 NA coding downstream 509911 26865773 ~ 26869148 (-)
trnas-uga_106 NA coding downstream 651665 26727313 ~ 26727394 (-)
trnak-uuu_100 NA coding downstream 653162 26725825 ~ 26725897 (-)
trnak-uuu_99 NA coding downstream 655213 26723774 ~ 26723846 (-)
trnas-aga_108 NA coding downstream 656016 26722965 ~ 26723043 (-)
flot1a flot1a,LOC107665160,LOC107549850,LOC107752515,LOC107666343,LOC103027319,LOC108433738 coding upstream 26261 27409088 ~ 27415650 (-)
pdk2b pdk2b,LOC107665156,LOC107752527,LOC107549851,LOC107753849,LOC107562510,LOC107666345 coding upstream 564169 27946996 ~ 27951997 (-)
LOC122343310 LOC107752528,LOC107549854 coding upstream 583482 27966309 ~ 27969769 (-)
wipf2b wipf2b,LOC107752530,LOC107549849,LOC107562512,LOC107665117 coding upstream 587083 27969910 ~ 27977175 (-)
jupb jupb,LOC107562513,LOC107752531,LOC107549862,LOC107665165,LOC105013272,LOC108438403 coding upstream 598243 27981070 ~ 28037700 (-)
trnak-cuu_3 NA non-coding downstream 381924 26997065 ~ 26997135 (-)
trnae-cuc_35 NA non-coding downstream 385248 26993740 ~ 26993811 (-)
G31426 NA non-coding downstream 390105 26988587 ~ 26988954 (-)
trnae-cuc_34 NA non-coding downstream 394500 26984490 ~ 26984559 (-)
trnae-cuc_33 NA non-coding downstream 397335 26981653 ~ 26981724 (-)
G31472 LOC107752514,LOC105892077,LOC107665159 non-coding upstream 15942 27398769 ~ 27400876 (-)
G31481 NA non-coding upstream 46303 27429130 ~ 27438241 (-)
G31484 tcf19l,LOC107753767 non-coding upstream 57839 27440666 ~ 27442686 (-)
G31507 NA non-coding upstream 174778 27557605 ~ 27649545 (-)
G31496 NA non-coding upstream 212166 27594993 ~ 27599290 (-)
G31463 LOC107665166,LOC107752513,LOC107549841 other downstream 11410 27366412 ~ 27367649 (-)
G31400 LOC102197881 other downstream 1053823 26324479 ~ 26325236 (-)
G31394 NA other downstream 1203810 26173699 ~ 26175249 (-)
G31314 NA other downstream 1817861 25559040 ~ 25561198 (-)
LOC122342407 LOC101068103,LOC105418166,LOC106522608,LOC108412963,LOC105419408,LOC108431938,LOC107395447,LOC106674638 other downstream 2618273 24754056 ~ 24760786 (-)
LOC122342454 kifc1,LOC107665178,LOC107753731,LOC107666336,LOC107549825,LOC107554333 other upstream 926 27383753 ~ 27389398 (-)
G31503 pvrl2l,LOC107549846,LOC107665153,LOC107554349,LOC107752518,LOC107753776,LOC107666334 other upstream 156528 27539355 ~ 27615941 (-)
G31508 LOC106519560,LOC107665151,LOC102211354,LOC101487824,LOC102313318,LOC102779181 other upstream 259865 27642692 ~ 27644732 (-)
eif1 eif1b,LOC107549864,LOC103043673,LOC107666344,LOC107665169 other upstream 682470 28065297 ~ 28067762 (-)
LOC122342471 si:dkeyp-113d7.10,LOC107753946,LOC107666338,LOC107563029,LOC107727707,LOC107549831 other upstream 737420 28120247 ~ 28130380 (-)

Expression


Co-expression Network