oxt (oxt,LOC107729605,LOC107745630,LOC107597959,LOC107674922,LOC107566857,LOC107670390)


Basic Information

Item Value
gene id oxt
gene name oxt,LOC107729605,LOC107745630,LOC107597959,LOC107674922,LOC107566857,LOC107670390
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056702.1
NCBI id CM032071.1
chromosome length 29200999
location 17901441 ~ 17902917 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XM_043237493.1
GTGCTAAAATCACGCAGCAAAGAGGTATAAAAAGAGTCTTCTCCCAGCGTACGAATGAACGTCGCTGCTTGAGACCTGAATCGCATCACTAGCTCTCCGTTTTAGCCTCGGTGAAATATGTCTGGAGGTCTTCTCTCGGCGGTCGGTCTGCTGTGTCTGCTGTCCGTTTGCTCGGCCTGTTACATCTCCAACTGCCCCATCGGAGGAAAACGAGCCGCGCCGGACTTGCCATCTCGACAGTGCATGTCGTGCGGTCCTGGAGATCGCGGCCGGTGTTTTGGTCCCAGTATCTGCTGCGGTGAAGGCATCGGCTGCTTGGTCGGCTCTCCGGAGACGCTCCGCTGTCTGGAGGAGGATTTCCTTCCTTCTCCGTGCGAAGCGTCTGGAAAAGCATGCGGTTACGAGGGACGCTGCGCTGCTCCCGGCGTCTGCTGTGACTCAGAGGGCTGCAGTATGGATCAGTCGTGTGTGGACGGAGACGCTGACGGAGCGGCCTCCAGCAGCCAAGACCTTCTGCTGAAGCTGCTGCACCTGTCTAACCACGCCCACCCCTACAGACTCCACCAATGAAACGCTCGCAGGAGAGTGACATCATCTCAGGAGGAGCCGCCCACCAACCGCAACAACTCATCACCTACTTTTTGTAAACCACGTTTGTATAGCCGCTAGGTATTTGTATGGCTAATACACATTAGTCGTGCTGTATAGATGATAGCTTGACTGTACGTCTGTGCAGCTATTAAACTCTGAGAGAAA

Function

symbol description
oxt Predicted to enable neuropeptide hormone activity. Acts upstream of or within ion homeostasis. Predicted to be located in extracellular region. Predicted to be active in extracellular space and secretory granule. Is expressed in several structures, including heart; liver; male organism; nervous system; and pleuroperitoneal region. Orthologous to human OXT (oxytocin/neurophysin I prepropeptide).

NR:

description
isotocin-neurophysin IT 1

GO:

id name namespace
GO:0050801 ion homeostasis biological_process
GO:0005576 extracellular region cellular_component
GO:0005185 neurohypophyseal hormone activity molecular_function

KEGG:

id description
K05242 AVP; arginine vasopressin

RNA

RNA id representative length rna type GC content exon number start site end site
XM_043237493.1 True 756 mRNA 0.55 4 17901441 17902917

Neighbor

gene id symbol gene type direction distance location
LOC122343009 zgc:65851,LOC107670379,LOC107668750,LOC107599600,LOC107708255,LOC107755851,LOC107573085 coding upstream 89978 17805840 ~ 17811463 (+)
kdr kdr,LOC107755244,LOC107665394,LOC107683984,LOC107718422 coding upstream 235544 17644435 ~ 17665897 (+)
clocka clock,clocka,LOC107701480 coding upstream 270619 17582070 ~ 17630822 (+)
nmu nmu,LOC107684000,LOC107755222,LOC107568121,LOC107701461,LOC107718432 coding upstream 322637 17565453 ~ 17578804 (+)
LOC122342653 l3hypdh,LOC107684001 coding upstream 411146 17483433 ~ 17490295 (+)
fabp1a fabp1,fabp1a,LOC107745323,LOC107597935 coding downstream 9522 17912439 ~ 17915594 (+)
exosc2 exosc2,exos2 coding downstream 30388 17933305 ~ 17937916 (+)
abl1 abl1,LOC107670387,LOC107597931,LOC107674916,LOC107566858 coding downstream 36767 17939684 ~ 17963519 (+)
ddx54 ddx54,LOC107729212,LOC107745378,LOC107674901,LOC107597958,LOC107566861,LOC102784149 coding downstream 82076 17984993 ~ 17997658 (+)
lman2la lman2l,lman2la,LOC107660366,LOC107565653,LOC102299173 coding downstream 299818 18202735 ~ 18210893 (+)
G29329 NA non-coding upstream 46077 17854461 ~ 17855364 (+)
G29334 NA non-coding upstream 77176 17823250 ~ 17824265 (+)
G29331 NA non-coding upstream 83025 17818146 ~ 17818416 (+)
G29317 NA non-coding upstream 83508 17817546 ~ 17817933 (+)
G29306 NA non-coding upstream 155124 17745528 ~ 17746317 (+)
G29318 LOC107745315,LOC107597934 non-coding downstream 13137 17916054 ~ 17922889 (+)
G29364 NA non-coding downstream 28967 17931884 ~ 17932404 (+)
G29476 NA non-coding downstream 96680 17999597 ~ 18002479 (+)
G29484 tbx3a,LOC107742157,LOC107597930,LOC107687999,LOC107728866 non-coding downstream 156418 18059335 ~ 18060916 (+)
G29544 NA non-coding downstream 532726 18435643 ~ 18460595 (+)
atp5mj NA other upstream 860611 17038419 ~ 17040830 (+)
G28982 NA other upstream 1427060 16473898 ~ 16474381 (+)
G28899 NA other upstream 1915715 15985219 ~ 15985726 (+)
G28891 NA other upstream 2059586 15841372 ~ 15841855 (+)
cdkn1d LOC107699204,LOC107719868,LOC107562144,LOC107601015,LOC107758204,LOC107687563 other upstream 2246163 15565499 ~ 15655278 (+)
G29526 NA other downstream 397498 18300415 ~ 18301189 (+)
G29545 NA other downstream 533543 18436460 ~ 18461317 (+)
G29642 NA other downstream 980262 18883179 ~ 18886402 (+)
G29814 LOC107660256 other downstream 1387303 19290220 ~ 19342911 (+)
G29835 NA other downstream 1828345 19731262 ~ 19786128 (+)

Expression


Co-expression Network