opn1sw1 (opn1sw)


Basic Information

Item Value
gene id opn1sw1
gene name opn1sw
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056702.1
NCBI id CM032071.1
chromosome length 29200999
location 6756012 ~ 6758188 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XM_043237696.1
ATGGATGCGTGGGCCTATCAATTTGGAAACCTCTCCAAAGTCAGCCCCTTCGAGGGCCCGCAGTACCATCTGGCCCCCAAGTGGGCTTTCTACCTCCAGGCAGCTTTCATGGGCTTTGTATTTCTGGTGGGCACACCTATGAACGCCATCGTCCTCTTCGTTACACTGAAGTACAAGAAACTCAGACAGCCTCTCAACTACATCCTGGTGAACATCTCCCTAGGAGGCTTCATTTTCGACACGTTCTCTGTAAGCCAAGTGTTCTTGTCCGCTCTTAGAGGTTATTTCTTCTTCGGTCATATGATGTGCGCGATGGAATCGGCAATGGGATCGATTGCAGGACTTGTGACAGGATGGTCCCTGGCGGTTCTGGCTTTCGAGAGATACGTGGTTATCTGCAAACCCTTTGGAAGCTTCAAGTTCGGACAAAGCCAGGCCATGGGAGCCGTTGCGCTCACCTGGATCATAGGTATCGGTTGTGCCACGCCACCGTTCTGGGGATGGAGCAGATACATTCCAGAGGGTCTCGGCACCTCCTGTGGACCTGACTGGTACACGAAAAGTGAGGAGTACAACTCGGAGAGCTACACTTACTTCCTAATGGTCACCTGCTTCATTCTGCCAATGATAATCATCATCTTCTCCTATTCACAACTTCTGGGAGCCCTGCGTGCTGTTGCAGCCCAGCAGGCCGAGTCTGCCTCCACCCAAAAGGCTGAGAAGGAAGTGTCCAGGATGGTTGTAGTGATGGTTGGCTCTTTTATAGTTTGCTATGGCCCTTACGCCCTCGCTGCCTTGTATTATGGCTATGCTGAGGATTCAAACAAGGATTACCGTCTGGTTGCCATCCCTGCTTTGTTCTCAAAGAGCTCCTGCGTGTACAACCCCCTAATCTACGCCTTCATGAACAAACAGTTCAATGCCTGCATCATGGAGACCGTATTTGGCAAAAAGATTGATGAGGGCTCGGAGGTTTCCAGCAAAACCGAAACCTCCTCCGTGTCCGCATAA

Function

symbol description
opn1sw Predicted to enable G protein-coupled photoreceptor activity. Involved in cellular response to UV-A. Located in perinuclear region of cytoplasm and plasma membrane. Implicated in blue color blindness.

NR:

description
PREDICTED: short-wave-sensitive opsin 1

GO:

id name namespace
GO:0007186 G protein-coupled receptor signaling pathway biological_process
GO:0007601 visual perception biological_process
GO:0007602 phototransduction biological_process
GO:0018298 protein-chromophore linkage biological_process
GO:0016021 integral component of membrane cellular_component
GO:0009881 photoreceptor activity molecular_function
GO:0004930 G protein-coupled receptor activity molecular_function

KEGG:

id description
K04252 OPN1SW; short wavelength-sensitive opsin

RNA

RNA id representative length rna type GC content exon number start site end site
XM_043237696.1 True 1011 mRNA 0.51 5 6756012 6758188

Neighbor

gene id symbol gene type direction distance location
mdm1 LOC107577767,LOC107655590,LOC107725562,LOC107694231 coding downstream 5762 6740893 ~ 6750250 (-)
il26 NA coding downstream 21283 6732341 ~ 6734729 (-)
LOC122343434 NA coding downstream 28179 6726585 ~ 6727833 (-)
ifng1r NA coding downstream 31609 6723047 ~ 6724403 (-)
ifng1 NA coding downstream 34863 6719218 ~ 6721149 (-)
irf5 LOC107577905,LOC107587141,LOC107725599,LOC107655585,LOC107694268,LOC107757280 coding upstream 18111 6776299 ~ 6784035 (-)
akap14 NA coding upstream 34179 6792367 ~ 6793435 (-)
gxylt1b gxylt1,LOC107729836,LOC107582079,LOC107694260 coding upstream 175905 6934093 ~ 6940296 (-)
yaf2 yaf2,LOC108439407,LOC105018284,LOC107725590 coding upstream 182258 6940446 ~ 6950897 (-)
zcrb1 zcrb1 coding upstream 193704 6951892 ~ 6954640 (-)
LOC122342911 NA non-coding downstream 366811 6377116 ~ 6389201 (-)
G26556 NA non-coding downstream 488598 6266832 ~ 6267414 (-)
G26541 NA non-coding downstream 521074 6186089 ~ 6234938 (-)
G26490 NA non-coding downstream 671802 6083590 ~ 6084210 (-)
G26487 NA non-coding downstream 678680 6077087 ~ 6077332 (-)
G26787 LOC107725579,LOC107655582 non-coding upstream 83786 6841974 ~ 6843849 (-)
G26790 LOC107725579,LOC107587145 non-coding upstream 87371 6845559 ~ 6908495 (-)
G26795 cntn1b,cntn1,LOC107581848,LOC107757284,LOC107694230,LOC107725506 non-coding upstream 101886 6860074 ~ 6862247 (-)
G26796 NA non-coding upstream 104535 6862723 ~ 6863382 (-)
G26799 NA non-coding upstream 125713 6883901 ~ 6956375 (-)
il22 NA other downstream 15271 6737641 ~ 6740741 (-)
msrb3 msrb3,LOC107725596,LOC107587134,LOC107757268,LOC107561995 other downstream 394528 6350491 ~ 6361484 (-)
arhgef39 arhgef39,LOC107725686,LOC107655603,LOC107757260,LOC107694288 other downstream 503364 6085892 ~ 6252648 (-)
mrps33 mrps33,LOC107694294,LOC107597883,LOC107725593,LOC107600452,LOC107655561 other downstream 815997 5938055 ~ 5940015 (-)
G26462 NA other downstream 842474 5906755 ~ 5913538 (-)
si:dkey-261e22.4 NA other upstream 456146 7214334 ~ 7220911 (-)
G26951 NA other upstream 796927 7555115 ~ 7558453 (-)
LOC122343432 NA other upstream 1489723 8247911 ~ 8249927 (-)
G27232 LOC107589947,LOC107725677,LOC107659846,LOC107586091,LOC107694692 other upstream 1702318 8460506 ~ 8468028 (-)
slc25a3a slc25a3a,slc25a3,LOC107744906,LOC107586622,LOC108437945,LOC105897470,LOC108279629,LOC107694680,LOC107593070 other upstream 1755442 8513630 ~ 8517583 (-)

Expression


Co-expression Network