CI01000004_10884499_10886045 (CBLN2A, CBLN2, CBLN2B)


Basic Information

Item Value
gene id CI01000004_10884499_10886045
gene name CBLN2A, CBLN2, CBLN2B
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 10884426 ~ 10886045 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000004_10884499_10886045.mRNA
TCATGTTGAGAGCCAGGGAACAGGGCTCTTTGGCCGTACTGGCCTCCACCCTTCTTTTGGGATGCGGCGTTGCGTTTTCCCTCGGACAGAATGACACAGAACCGGTAGTTTTGGAAGGAAAATGTTTAGTTGTGTGTGACTCGAACCCGTCCGCCGAAGGAGGAGTGACCTCGTCGTTTGGGATATCTGTCCGCGCTGCTGGTGCTAAAGTGGCTTTTTCTGCTGTCAGAGGAACTAACCATGAACCATCAGAAATGAGTAACAAGTCCATGACGATCTACTTTGATCAGGTACTAGTGAACATTGGAAATCACTTCGATCTTAAGGCGAGTGTATTTCAAGCTCCTCGGCGAGGCATTTACAGCTTCAGCTTTCACGTCGTGAAGGTCAATCTGATGCATAATGAATACCCAATAATATCTGCGTTTGCCGGTGATCAAGATGTGACCCGGGAGGCAGCGAGTAACAGTGTTCTTCTTCACCTGGAGCGTGAAGACAGACTCTATCTCAAACTAGAGAGAGGAAACCTCATGGGCGGGTGGAAGTACTCCACATTCTCTGGCTTCCTTGTTTTCCCTCTCTGAGTGAATATAACTCACTTTAAATGGCCCAGACTGAAGACCAAGGGACTTTTCCATATCTGCTTTCAAAAATAAA

Function

symbol description
cbln2b Is expressed in dorsal habenular nucleus. Orthologous to human CBLN2 (cerebellin 2 precursor).
cbln2a Orthologous to human CBLN2 (cerebellin 2 precursor).
cbln2 Predicted to be involved in maintenance of synapse structure and spontaneous synaptic transmission. Predicted to act upstream of or within positive regulation of synapse assembly. Predicted to be located in extracellular space. Predicted to be active in glutamatergic synapse.

GO:

id name namespace
GO:0005575 cellular_component cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000004_10884499_10886045.mRNA True 657 mRNA 0.47 3 10884426 10886045

Neighbor

gene id symbol gene type direction distance location
CI01000004_10847650_10847940 NA coding downstream 36431 10847557 ~ 10847995 (-)
CI01000004_10788659_10809214 JPH1B, JPH1 coding downstream 74621 10788659 ~ 10809805 (-)
CI01000004_10766385_10766860 TCEB1B, TCEB1, GM14517, TCEB1A coding downstream 117566 10766340 ~ 10766860 (-)
CI01000004_10757852_10760211 NA coding downstream 123284 10757543 ~ 10761142 (-)
CI01000004_10692864_10704094 TRPA1A coding downstream 180332 10692637 ~ 10704094 (-)
CI01000004_10944147_11018487 CTNND2B, CTNND2 coding upstream 56332 10942377 ~ 11018487 (-)
CI01000004_11043026_11046108 NA coding upstream 156835 11042880 ~ 11046108 (-)
CI01000004_11052319_11059170 RP1 coding upstream 165349 11051394 ~ 11059170 (-)
CI01000004_11073846_11086948 NA coding upstream 187634 11073679 ~ 11086948 (-)
CI01000004_11172493_11174547 MYL12.2, MYL12.1, MLRN, MYL12A, MYL9 coding upstream 286170 11172215 ~ 11175867 (-)
G31258 NA non-coding downstream 3561 10880295 ~ 10880865 (-)
G31245 NA non-coding downstream 25538 10858515 ~ 10858888 (-)
G31243 NA non-coding downstream 34792 10849431 ~ 10849634 (-)
G31234 NA non-coding downstream 52522 10831521 ~ 10831904 (-)
G31224 NA non-coding downstream 66073 10818150 ~ 10818353 (-)
G31265 NA non-coding upstream 3563 10889608 ~ 10889813 (-)
G31271 NA non-coding upstream 15084 10901129 ~ 10901386 (-)
G31455 NA non-coding upstream 21277 10907322 ~ 10913522 (-)
G31456 NA non-coding upstream 30854 10916899 ~ 10919641 (-)
G31454 NA non-coding upstream 35390 10921435 ~ 10922124 (-)
G31203 NA other downstream 133785 10746437 ~ 10750641 (-)
G30316 NA other downstream 1477505 9377937 ~ 9406921 (-)
G29746 NA other downstream 2526299 8354498 ~ 8358127 (-)
G29656 NA other downstream 2918926 7964364 ~ 7965500 (-)
G29388 NA other downstream 4252519 6631293 ~ 6631907 (-)
CI01000004_11407198_11412220 ADCYAP1B, ADCYAP1 other upstream 521420 11406957 ~ 11412907 (-)
G32150 NA other upstream 890474 11776519 ~ 11780951 (-)
G32207 NA other upstream 1490123 12376168 ~ 12384780 (-)
CI01000004_14543631_14551256 NA other upstream 3664755 14541515 ~ 14551352 (-)
G33746 NA other upstream 3682748 14568793 ~ 14569264 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_016471 cbln2a coding NC_007113.7 CM002886.2 30458706 ~ 30460293 (-)