LOC122342648


Basic Information

Item Value
gene id LOC122342648
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056702.1
NCBI id CM032071.1
chromosome length 29200999
location 14863033 ~ 14864100 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XR_006250624.1
CGGCTGTGAGACCCCAGGTTCTTATGAGACTCTCAAAAACCAAGAAGCATGTCAGCGAGCTTATGGTGGTTCCATGTGTTGCCAAGTGTGTACGAGACAGGATCAAGCGAGCTTTCCTCATTGAGGAGCAGAAGATTGTGGTCAAAGTACTGAAGGCACAGGCACAAAGCCAGAAGTCTAAGTAGAAGGTGATTTTTACTGTTCAAA

Function

GO:

id name namespace
GO:0006412 translation biological_process
GO:0005840 ribosome cellular_component
GO:0003735 structural constituent of ribosome molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XR_006250624.1 True 207 lncRNA 0.46 2 14863033 14864100

Neighbor

gene id symbol gene type direction distance location
LOC122342863 cpne8,LOC107569221,LOC107666208,LOC108279828,LOC101886030,LOC108427072,LOC108244036 coding upstream 55667 14784476 ~ 14807366 (+)
LOC122342644 tbc1d22a,LOC107721154,LOC107689730 coding upstream 101061 14758492 ~ 14761972 (+)
LOC122342641 tbc1d22a,LOC107689730 coding upstream 108676 14725899 ~ 14754357 (+)
gramd4a gramd4,gramd4a,LOC107721158,LOC107689728,LOC107710742 coding upstream 747725 14074263 ~ 14115308 (+)
celsr1a celsr1a,LOC107569230,LOC107710744,LOC107666207,LOC107689740 coding upstream 797352 13994130 ~ 14065681 (+)
LOC122342621 zbed4,LOC107744591,LOC107663563,LOC107563622 coding downstream 272821 15136921 ~ 15143411 (+)
creld2 LOC107730684,LOC107699369,LOC107601011 coding downstream 285033 15149133 ~ 15157634 (+)
LOC122343379 ppm1j,LOC107668166,LOC107708158 coding downstream 478162 15342262 ~ 15355555 (+)
nup50 nup50,LOC107699201,LOC107562145,LOC107687567,LOC107601009,LOC107719874 coding downstream 731561 15595661 ~ 15602006 (+)
LOC122342219 LOC107554691,LOC107656224 coding downstream 774412 15638512 ~ 15644874 (+)
G28726 NA non-coding upstream 8282 14834630 ~ 14854751 (+)
G28667 NA non-coding upstream 53372 14808597 ~ 14809661 (+)
G28503 NA non-coding upstream 870202 13992023 ~ 13992831 (+)
G28486 NA non-coding upstream 1034496 13828025 ~ 13828537 (+)
G28446 NA non-coding upstream 1102921 13757967 ~ 13760112 (+)
G28745 NA non-coding downstream 250011 15114111 ~ 15114528 (+)
LOC122343380 LOC107699369,LOC107730684,LOC107601011 non-coding downstream 475518 15339618 ~ 15341504 (+)
G28797 NA non-coding downstream 510010 15374110 ~ 15374537 (+)
G28813 NA non-coding downstream 623976 15488076 ~ 15492182 (+)
G28882 NA non-coding downstream 861092 15725192 ~ 15725554 (+)
tafa5a fam19a5a,fam19a5,LOC107552289,LOC107689731,LOC107563619,LOC107721159,LOC106609108,LOC103356475 other upstream 380212 14400029 ~ 14482821 (+)
tbc1d22a tbc1d22a,LOC107689730,LOC107710738 other upstream 568415 14177430 ~ 14294618 (+)
trmu trmu other upstream 871261 13985517 ~ 13991772 (+)
LOC122342701 im:7143923,cpne8,LOC101886030,LOC107566841,LOC108279828,LOC107689738,LOC108427072,LOC103365370,LOC107666208,LOC102193326,LOC102297242 other upstream 901935 13882894 ~ 13961098 (+)
vezt vezt,LOC107689227,LOC107667718,LOC107597031,LOC107755144 other upstream 1429427 13405929 ~ 13433606 (+)
LOC122343376 LOC107699368,LOC107601007,LOC107733210,LOC105896948,LOC104933464 other downstream 293655 15157755 ~ 15214432 (+)
LOC122342869 NA other downstream 549047 15413147 ~ 15420303 (+)
G28806 LOC107744205,LOC107601002,LOC107687568,LOC107699198 other downstream 575234 15439334 ~ 15555682 (+)
cdkn1d LOC107699204,LOC107719868,LOC107562144,LOC107601015,LOC107758204,LOC107687563 other downstream 701399 15565499 ~ 15655278 (+)
G28891 NA other downstream 977272 15841372 ~ 15841855 (+)

Expression


Co-expression Network