CI01000004_11666900_11667179



Basic Information


Item Value
gene id CI01000004_11666900_11667179
gene name NA
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 11666900 ~ 11667659 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>CI01000004_11666900_11667179.mRNA
TCAAAGGGTTATCGCACCAAGAGGCAGAGCAAAAGCAAGACCAAACAGAAAAGTCCTCATCGCCCGGGACGTAGCAGCCTTTTATCAATGGGAAATCCCCAAATTCCCCAGGTATTCTCCATCCTCTGATCACCCTGTCAATGCGCCATTTAAACACATTATATTAAAGAAATACACTGAATTGCTTTACACTGAACTTGTCATTTGCCTAACACAGCAGCCTGCCCGTGCCAAAAGGGATGAGAATGCCGTGGGAAAAAGACCATGGCTGAGAAGTTAAAGCATTATACGCATGTAAGGCTCCTTCCCAGGTAATATATTGTAAACATATTTACATAATATAAAAAAAATGGTATTAGGCTTAACAGATGTTCTTTCCTTACAGGTTCCCTGAATCAGGAAAAAGAGGGATTGCATATATAGAGATACATCACCATGTTTCATAAAGAATATTAGTTATGCTTATGAAAGTAATCATTTATCCTTCTACAGCTTTTATTTTTTCAATAATCTGGTAAATATAATAGATTCTCCCAATTCTGTAAGTCTAAGAGGCATCACTAGGCGGCAGTATTTACTCAAGAGATGAGCACTCAAGCCAGCTCCGCTTGTCACAATGTTTATTTGATGTCTGTTGATCTTTATCTGTTAACTACA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
CI01000004_11666900_11667179.mRNA False 657 mRNA 0.38 1 11666900 11667556
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000004_11622516_11634475 NA coding upstream 31975 11622516 ~ 11634925 (+)
CI01000004_11608619_11618346 MALRD1 coding upstream 48473 11608619 ~ 11618427 (+)
CI01000004_11598169_11606266 MALRD1 coding upstream 60617 11598169 ~ 11606283 (+)
CI01000004_11592217_11595358 NA coding upstream 71542 11592217 ~ 11595358 (+)
CI01000004_11547197_11557429 CACNB2B coding upstream 109346 11547197 ~ 11560552 (+)
CI01000004_11668089_11670426 ACKR4A coding downstream 147 11667703 ~ 11670922 (+)
CI01000004_11747225_11747971 RNF182 coding downstream 78980 11746536 ~ 11748095 (+)
CI01000004_11750356_11765031 RANBP9 coding downstream 82209 11749765 ~ 11766104 (+)
CI01000004_11771176_11773391 EPDR1 coding downstream 103533 11771089 ~ 11773516 (+)
CI01000004_11776595_11786233 STARD3NL coding downstream 108863 11776419 ~ 11786917 (+)
G31690 NA non-coding upstream 100745 11515811 ~ 11566155 (+)
G31677 NA non-coding upstream 200529 11466036 ~ 11466371 (+)
G31665 NA non-coding upstream 259995 11406674 ~ 11406905 (+)
G31664 NA non-coding upstream 260289 11406286 ~ 11406611 (+)
G31721 NA non-coding downstream 25299 11692855 ~ 11694150 (+)
G31723 NA non-coding downstream 26831 11694387 ~ 11696280 (+)
G31727 NA non-coding downstream 39028 11706584 ~ 11706970 (+)
G31737 NA non-coding downstream 80969 11748525 ~ 11748761 (+)
G31625 NA non-coding downstream 123441 11790997 ~ 11803727 (+)
G31710 NA other upstream 24500 11637251 ~ 11642400 (+)
G30797 NA other upstream 1169112 10497376 ~ 10497788 (+)
CI01000004_08976512_08980033 TTPA other upstream 2685916 8976254 ~ 8980984 (+)
G28859 NA other upstream 3067297 8599235 ~ 8599603 (+)
CI01000004_08414451_08436256 NA other upstream 3215673 8414316 ~ 8439933 (+)
G31865 NA other downstream 524574 12192130 ~ 12197418 (+)
CI01000004_12646972_12652534 NA other downstream 975198 12646838 ~ 12652570 (+)
CI01000004_14036114_14036449 KIAA0040 other downstream 2355991 14035393 ~ 14039142 (+)
CI01000004_15091390_15096502 GA45B, GADD45B, GADD45BB other downstream 3423688 15091200 ~ 15097173 (+)
G34220 NA other downstream 4271801 15939357 ~ 15939950 (+)

Expression


CI01000004_11666900_11667179 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

CI01000004_11666900_11667179 Expression in each Bioproject

Bar chart with 25 bars.
CI01000004_11666900_11667179 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network