G32770 (figla)


Basic Information

Item Value
gene id G32770
gene name figla
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056703.1
NCBI id CM032072.1
chromosome length 32833783
location 2608216 ~ 2609601 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU48269
GCTCCAGAGATCAGAGCAGTCCGTCTCCAAGCTGGAGCAGTTGATCCCGGTCTCCAGCAAAACATTTGCATCTCCATTACTCTGAGGATTGAGCAAAGCCAGCGCGTTACAGGAGAACCTCTCAGCACACTAGTGAGGGAAGTGCGCACTGCGGGCAGCGAGAGACTCACGGCGGCTGAGGAGTGATGGAGGACGGCCGACAGGAGCCGGATGTACTCGGTGGCGGCCTTCAGCATGTCCACTTTACTGGGCTTTCGGTCCCGAGGCATGACCGGAACGATGCGCCGCAGGTACGAGAACATGCTGTTCAGACTCCGGGTCTCTCCTTGGCGTTGGCGAGCTGTCTCCTCCTCACGGCTTTATCCCGGTCCTCGGTGTCGATATACCGGCCGTCATCCAAGCGGACGAATTTACCGATATTGACGTGAACCGGAAGCGAGGGCTCAGCGCTGTCGCGTAATAAAACATCACCCATCAGCTCTCGCTCCGGGACCTTCATGAGCCCCACCACAGCCCTGAACCTCCTGCTGCTCATCTCAGTTTACACGACACGACACGACACGACACGACACGACACGACACGACACGACACGACACGACGACACGCTCAGCGCACCGCATAACTCAGGGTGCCCG

Function

symbol description
figla Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II transcription regulatory region sequence-specific DNA binding activity. Acts upstream of or within female gonad development. Is expressed in gonad; ovary; and testis. Human ortholog(s) of this gene implicated in primary ovarian insufficiency 6. Orthologous to human FIGLA (folliculogenesis specific bHLH transcription factor).

NR:

description
bHLH transcription factor FIG alpha

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU48269 True 636 lncRNA 0.59 2 2608216 2609601

Neighbor

gene id symbol gene type direction distance location
LOC122345384 H2AFV,h2afvb,LOC107386217,LOC105007341,LOC107668744 coding upstream 76623 2528502 ~ 2531593 (+)
LOC122345419 man1b1b,LOC107709694,LOC107681241,LOC107560236,LOC107757969,LOC107690671,LOC107587425 coding upstream 331182 2270213 ~ 2277034 (+)
LOC122346086 LOC107587426,LOC107757959,LOC107709681,LOC107560220,LOC107681216,LOC107560224,LOC107709689 coding upstream 343631 2249658 ~ 2264585 (+)
LOC122346081 LOC107681222,LOC107709689,LOC107560224,LOC107757958,LOC107587469,LOC107690695 coding upstream 400671 2178583 ~ 2207545 (+)
LOC122346053 edc4,LOC107733561,LOC107726309 coding upstream 690764 1906927 ~ 1917452 (+)
LOC122345789 npffr1l2,LOC107755826,LOC107599640,LOC107668729,LOC107708240,LOC107654224 coding downstream 107412 2717013 ~ 2725424 (+)
hk2 hk2,LOC107668748,LOC107755855,LOC106585103,LOC108255852,LOC108411364,LOC107708252,LOC107599625 coding downstream 149754 2759355 ~ 2812420 (+)
pebp1 pebp1 coding downstream 808303 3417904 ~ 3422144 (+)
suds3 suds3,LOC107569732,LOC107708245 coding downstream 887648 3497249 ~ 3505203 (+)
hspb8 hspb8,LOC107720866 coding downstream 1000871 3610472 ~ 3619055 (+)
G32749 NA non-coding upstream 8577 2598250 ~ 2599639 (+)
G32765 NA non-coding upstream 28433 2578586 ~ 2579783 (+)
G32737 NA non-coding upstream 187385 2418377 ~ 2420831 (+)
G32702 NA non-coding upstream 364329 2243667 ~ 2243887 (+)
G32694 NA non-coding upstream 530783 2076954 ~ 2077433 (+)
G32798 NA non-coding downstream 256565 2866166 ~ 2867373 (+)
G32819 sema4c,LOC107557380,LOC107708238,LOC107699920,LOC107697240 non-coding downstream 338492 2948093 ~ 3024488 (+)
LOC122345883 NA non-coding downstream 571208 3180809 ~ 3186522 (+)
G32934 NA non-coding downstream 683673 3293274 ~ 3293558 (+)
G32955 NA non-coding downstream 777893 3387494 ~ 3387728 (+)
G32706 LOC107560224,LOC107681222,LOC107709689,LOC107690695,LOC107757958,LOC107587469 other upstream 340022 2265145 ~ 2268194 (+)
LOC122345711 LOC107556260,LOC107714787,LOC107691117,LOC107551460,LOC107715220,LOC107690391,LOC565819 other upstream 589066 2010217 ~ 2019150 (+)
LOC122346050 nutf2,LOC107726276,LOC107692933,LOC107733565 other upstream 702717 1900627 ~ 1905499 (+)
G32620 prrc2b,LOC107704672,LOC107562325 other upstream 765203 1835148 ~ 1843013 (+)
G32611 prrc2b,LOC107704672 other upstream 782102 1822654 ~ 1826114 (+)
LOC122345783 npffr1l2,LOC107755826,LOC107599640,LOC107668729,LOC107708240,LOC107654224 other downstream 17483 2627084 ~ 2649361 (+)
tbx1 tbx1,LOC107755862,LOC107699917,LOC107708247 other downstream 719199 3328800 ~ 3343070 (+)
G33015 NA other downstream 995585 3605186 ~ 4144396 (+)
G33174 NA other downstream 2012906 4622507 ~ 4623060 (+)
fbrsl1 LOC107656817,LOC107600129 other downstream 2034500 4644101 ~ 4902403 (+)

Expression


Co-expression Network