G35812 (arhgap25,LOC107597266,LOC107743332,LOC107654642)


Basic Information

Item Value
gene id G35812
gene name arhgap25,LOC107597266,LOC107743332,LOC107654642
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056703.1
NCBI id CM032072.1
chromosome length 32833783
location 12255480 ~ 12256812 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU52729
AGATGTAACTCAGGAGGTTGTAGTTCACTTTCGGCAGATGGCTGATTTGTACCTCCAGCTTTTCTTTGCCCTGGGATTGATCGTGTTGCAGTTAGTTATAGGATCAGTGCTCATCTGATATACTGTTTTTGCGAATGTGCTTCTCACCGCTGCAGTGGCGGCATCCAGCGTCAGAGTGCTGTCAAGGAAGGCCTGATACTGCGTCCAAGGCACAACAGGTTCAGGAAGCTCTCTGAGGTACAGCTTAAGTAAGGACCCCACCGTGTGGACATCGGTGTCACTGGGGAATGACGGCCTCTCTCCGGCATCAAAGGCCTCTCTGAACTGTTTGACCTGGTTGTCCTGTCCTGGCAGGCGAAAGATGCCCTCCTCACTCAGACCGTGCTCTCTGATGAATTCAGCACACTTCTCCACCAGGATGGGCACCAGACGTGGTCCAAATTTCTTCTCATACACCATCATATCCGAAAGGCTCTTTCCAAA

Function

symbol description
arhgap25 Predicted to enable GTPase activator activity. Predicted to be involved in several processes, including activation of GTPase activity; negative regulation of small GTPase mediated signal transduction; and phagocytosis, engulfment. Predicted to act upstream of or within signal transduction. Predicted to be active in phagocytic cup. Orthologous to human ARHGAP25 (Rho GTPase activating protein 25).

NR:

description
PREDICTED: rho GTPase-activating protein 25-like isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU52729 True 483 lncRNA 0.51 2 12255480 12256812

Neighbor

gene id symbol gene type direction distance location
LOC122345275 LOC107597264,LOC107672815,LOC107742671 coding downstream 59103 12190702 ~ 12196377 (-)
LOC122344646 NA coding downstream 78265 12173037 ~ 12177215 (-)
LOC122345274 NA coding downstream 82478 12169594 ~ 12173002 (-)
gab3 LOC107746243,LOC107597263,LOC107672781,LOC107663235,LOC107741201 coding downstream 332471 11902322 ~ 11923009 (-)
shisa2a shisa2,LOC107746248,LOC107672960,LOC107597350,LOC107741289,LOC107557100 coding downstream 406525 11847127 ~ 11848955 (-)
LOC122344659 NA coding upstream 15405 12272217 ~ 12273638 (-)
LOC122345273 NA coding upstream 100024 12356836 ~ 12363715 (-)
arhgap25 LOC107741203,LOC107557123,LOC107663229,LOC107654642,LOC107743332,LOC107597266 coding upstream 124552 12381364 ~ 12394042 (-)
cds2 cds2,LOC107597267,LOC107654641,LOC107741205,LOC107663217 coding upstream 139470 12396282 ~ 12409668 (-)
hs3st1l2 hs3st1l2,LOC107557106,LOC107741295,LOC107743333,LOC107654638,LOC107663220,LOC107578102 coding upstream 155529 12412341 ~ 12428382 (-)
G35805 NA non-coding downstream 6772 12226918 ~ 12248708 (-)
G35804 NA non-coding downstream 7971 12228582 ~ 12247509 (-)
G35797 NA non-coding downstream 72501 12181487 ~ 12182979 (-)
LOC122345280 NA non-coding downstream 75730 12179051 ~ 12179750 (-)
G35690 LOC107597260,LOC107746241,LOC107672756,LOC107741198,LOC107663227,LOC107557115 non-coding downstream 384427 11866762 ~ 11871053 (-)
G35922 LOC107696053,LOC107654639,LOC107743336,LOC107595973 non-coding upstream 186975 12443787 ~ 12445220 (-)
G35923 NA non-coding upstream 191402 12448214 ~ 12450765 (-)
G35928 NA non-coding upstream 207094 12463906 ~ 12515550 (-)
G35949 NA non-coding upstream 275578 12532390 ~ 12537802 (-)
LOC122345380 NA non-coding upstream 345404 12602216 ~ 12606938 (-)
sh2d1aa sh2d1aa,LOC107713049,LOC107741293,LOC107663232,LOC107557102 other downstream 86070 12165403 ~ 12169410 (-)
msna msna,msn,moes,LOC107746233,LOC107597256,LOC107672695,LOC107663223,LOC107741191 other downstream 439536 11795656 ~ 11815944 (-)
G35554 LOC100304549,LOC100219516,LOC106514001,LOC103353280 other downstream 602853 11583780 ~ 11652627 (-)
hmgn7 hmgn7,LOC107672554,LOC107756557,LOC107680402,LOC107565427,LOC107748629,LOC107597243,LOC108260037,LOC108442050 other downstream 788358 11419955 ~ 11467122 (-)
slc25a15b slc25a15b,LOC107744499,LOC107687678,LOC107599942,LOC107726376,LOC107672737 other downstream 1286362 10960311 ~ 10969118 (-)
G35825 tenm1,LOC107557119,LOC107713050,LOC107597323,LOC107741271 other upstream 60991 12317803 ~ 12319685 (-)
G35936 NA other upstream 245102 12501914 ~ 12505958 (-)
G36047 NA other upstream 797032 13053844 ~ 13054857 (-)
h3f3c h3f3b,H3F3A,LOC101073377,LOC105909691,LOC107388308,LOC105888650 other upstream 1322249 13579061 ~ 13582290 (-)
lrch2 lrch2,LOC107700248,LOC107746375,LOC107710563 other upstream 1397482 13654294 ~ 13699226 (-)

Expression


Co-expression Network