G37248 (ncor2,LOC107687981,LOC107742750,LOC107566019,LOC107684513)


Basic Information

Item Value
gene id G37248
gene name ncor2,LOC107687981,LOC107742750,LOC107566019,LOC107684513
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056703.1
NCBI id CM032072.1
chromosome length 32833783
location 16493363 ~ 16494405 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU54953
AATTTGATCCTGCAACTCTGCCCAGGGGAATCCCAATTGAGCCAGCAGCATATTACCTGCCCCGTCACCTGCCCCCTGGCCCTGGCTACCCTCATCCCTACCCACCCTACCTGATCAGAGGTTTCCCTGAAACAGCAGCCCTGGAGAACAGACAGACACTCTTCAATGACTACATTACCTCCCAGCAGATGCACCAGTGGCCAGCTGCTGCCGCCATGGCTGCTCAGAGACCCGACCTGCTCAGAGGCCTAACGCCTCGAGAGCAGTCTCTTAACTTAGCCTACTCACCTACACCAAGAGGAACATCTGCATCTCCCATGGATCGGGATCACATACATCCCAGG

Function

symbol description
ncor2 Predicted to enable transcription corepressor activity. Acts upstream of or within hematopoietic stem cell differentiation; macrophage differentiation; and neutrophil differentiation. Is expressed in several structures, including anterior axial hypoblast; cardiovascular system; central nervous system; eye; and pleuroperitoneal region. Human ortholog(s) of this gene implicated in osteoarthritis. Orthologous to human NCOR2 (nuclear receptor corepressor 2).

NR:

description
PREDICTED: nuclear receptor corepressor 2 isoform X6

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU54953 True 344 lncRNA 0.56 3 16493363 16494405

Neighbor

gene id symbol gene type direction distance location
LOC122344715 vps37b,LOC107673398,LOC107594993,LOC107656485,LOC107587312,LOC107709855,LOC107721558 coding downstream 77358 16413057 ~ 16416005 (-)
si:ch211-204c21.1 LOC107746847,LOC107561610,LOC107680600,LOC107719926,LOC107660265,LOC107553608 coding downstream 355200 16115390 ~ 16138163 (-)
LOC122346134 LOC107681310 coding downstream 378939 16095748 ~ 16114424 (-)
mccc2 mccc2,LOC107746845,LOC107680610,LOC107552565,LOC107660263,LOC107553609,LOC107719925 coding downstream 398026 16089065 ~ 16095337 (-)
smn1 smn1,LOC107660268,LOC107553605,LOC107719932,LOC107681471,LOC107746843,LOC107552536 coding downstream 405953 16084818 ~ 16087410 (-)
LOC122344899 LOC107663257,LOC107742022,LOC107570120 coding upstream 764061 17258466 ~ 17259947 (-)
LOC122345238 cfap157,LOC107587652,LOC107672550,LOC107731015 coding upstream 821976 17316381 ~ 17321058 (-)
LOC122344736 apba1,apba1a,LOC107587500,LOC107720269,LOC107756314,LOC107567151 coding upstream 834791 17329196 ~ 17345615 (-)
LOC122345546 LOC107699749,LOC107587493,LOC107756319,LOC107703272,LOC107567144,LOC107720200 coding upstream 860524 17354929 ~ 17359741 (-)
LOC122344712 ckmt2b,ckmt2,LOC107720280 coding upstream 887626 17382031 ~ 17384148 (-)
G37249 NA non-coding downstream 8249 16474708 ~ 16485114 (-)
G37239 NA non-coding downstream 11277 16389924 ~ 16482086 (-)
G37247 NA non-coding downstream 49606 16436469 ~ 16443757 (-)
G37212 NA non-coding downstream 161286 16330931 ~ 16332077 (-)
G37092 NA non-coding downstream 514623 15894684 ~ 15978740 (-)
G37266 NA non-coding upstream 177347 16671752 ~ 16672934 (-)
G37281 NA non-coding upstream 206856 16701261 ~ 16704191 (-)
G37294 NA non-coding upstream 330196 16824601 ~ 16827475 (-)
G37296 NA non-coding upstream 331379 16825784 ~ 16826226 (-)
LOC122345772 NA non-coding upstream 364195 16858600 ~ 16858976 (-)
LOC122344728 uprt,LOC107733222,LOC107672530,LOC107680369,LOC107748634 other downstream 114848 16376266 ~ 16378515 (-)
LOC122344710 LOC107755722,LOC107681456,LOC107700059,LOC107553585,LOC107727439 other downstream 236371 16253952 ~ 16256992 (-)
cxcl20 NA other downstream 634028 15857240 ~ 15859335 (-)
cxcl11.1 LOC107680787,LOC107552555,LOC107718351,LOC107553572,LOC107676630 other downstream 637555 15854920 ~ 15855808 (-)
LOC122345695 LOC107718358,LOC107553579,LOC107676641,LOC107680767,LOC107746876 other downstream 646327 15846036 ~ 15847036 (-)
G37258 ncor2,LOC107687981,LOC107684513,LOC107753125 other upstream 102450 16596855 ~ 16633121 (-)
G37277 ncam1a,LOC107681081,LOC107548183,LOC107756101 other upstream 192855 16687260 ~ 16713167 (-)
LOC122345693 NA other upstream 293404 16787809 ~ 16859931 (-)
LOC122344738 acsl1b,LOC107571490,LOC107678619,LOC107758469,LOC107552354,LOC108274927 other upstream 852064 17346469 ~ 17350380 (-)
mtx3 cmya5,mtx3,LOC107699728,LOC107703257,LOC107720274,LOC107756304,LOC107555495,LOC107756305,LOC107720223,LOC107703259 other upstream 2681058 19175463 ~ 19183978 (-)

Expression


Co-expression Network