G37310


Basic Information

Item Value
gene id G37310
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056703.1
NCBI id CM032072.1
chromosome length 32833783
location 16890704 ~ 16891190 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU55038
cccattcgtaagactggaacactgggaaacgtcccacgttctagtgaacagggacgtgcggaagtccagccttcccgtaggaggtctcggaacgaatacgcatatggacagtatttcagtttgcatatggaaaattggaggtgattgaacccttcttagacgggcagaaggtctgccgggaaacacgggctctaaggctatgccgtggaaatacacacataaagtcctcttggggtactttacatggctcccagccctcaccggttctcacggattcatcgagagggcctggcgccggatgctccgcaacatctggctgccgaggggaatggaggagctcgacagggtctactgtatggacgctctggagcggttaacaagccgacccgaaaccgggcctctcagtgtttctacccgtttgaggtgagaacacaggaggataccggttccacacgtaggctatagaatctagcaatcgtgttggggt

Function

NR:

description
SH3 and multiple ankyrin repeat domains protein 3-like isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU55038 True 487 lncRNA 0.54 1 16890704 16891190

Neighbor

gene id symbol gene type direction distance location
LOC122344715 vps37b,LOC107673398,LOC107594993,LOC107656485,LOC107587312,LOC107709855,LOC107721558 coding downstream 474699 16413057 ~ 16416005 (-)
si:ch211-204c21.1 LOC107746847,LOC107561610,LOC107680600,LOC107719926,LOC107660265,LOC107553608 coding downstream 752541 16115390 ~ 16138163 (-)
LOC122346134 LOC107681310 coding downstream 776280 16095748 ~ 16114424 (-)
mccc2 mccc2,LOC107746845,LOC107680610,LOC107552565,LOC107660263,LOC107553609,LOC107719925 coding downstream 795367 16089065 ~ 16095337 (-)
smn1 smn1,LOC107660268,LOC107553605,LOC107719932,LOC107681471,LOC107746843,LOC107552536 coding downstream 803294 16084818 ~ 16087410 (-)
LOC122344899 LOC107663257,LOC107742022,LOC107570120 coding upstream 367276 17258466 ~ 17259947 (-)
LOC122345238 cfap157,LOC107587652,LOC107672550,LOC107731015 coding upstream 425191 17316381 ~ 17321058 (-)
LOC122344736 apba1,apba1a,LOC107587500,LOC107720269,LOC107756314,LOC107567151 coding upstream 438006 17329196 ~ 17345615 (-)
LOC122345546 LOC107699749,LOC107587493,LOC107756319,LOC107703272,LOC107567144,LOC107720200 coding upstream 463739 17354929 ~ 17359741 (-)
LOC122344712 ckmt2b,ckmt2,LOC107720280 coding upstream 490841 17382031 ~ 17384148 (-)
G37309 NA non-coding downstream 386 16889042 ~ 16890318 (-)
LOC122345772 NA non-coding downstream 31728 16858600 ~ 16858976 (-)
G37294 NA non-coding downstream 63229 16824601 ~ 16827475 (-)
G37296 NA non-coding downstream 64478 16825784 ~ 16826226 (-)
G37281 NA non-coding downstream 186513 16701261 ~ 16704191 (-)
G37340 NA non-coding upstream 271487 17162677 ~ 17165152 (-)
G37363 NA non-coding upstream 460125 17351315 ~ 17352410 (-)
LOC122345155 NA non-coding upstream 754906 17646096 ~ 17686024 (-)
G37427 NA non-coding upstream 777069 17668259 ~ 17692145 (-)
G37439 NA non-coding upstream 1000767 17891957 ~ 17893318 (-)
LOC122345693 NA other downstream 30773 16787809 ~ 16859931 (-)
G37277 ncam1a,LOC107681081,LOC107548183,LOC107756101 other downstream 177537 16687260 ~ 16713167 (-)
G37258 ncor2,LOC107687981,LOC107684513,LOC107753125 other downstream 257583 16596855 ~ 16633121 (-)
LOC122344728 uprt,LOC107733222,LOC107672530,LOC107680369,LOC107748634 other downstream 512189 16376266 ~ 16378515 (-)
LOC122344710 LOC107755722,LOC107681456,LOC107700059,LOC107553585,LOC107727439 other downstream 633712 16253952 ~ 16256992 (-)
LOC122344738 acsl1b,LOC107571490,LOC107678619,LOC107758469,LOC107552354,LOC108274927 other upstream 455279 17346469 ~ 17350380 (-)
mtx3 cmya5,mtx3,LOC107699728,LOC107703257,LOC107720274,LOC107756304,LOC107555495,LOC107756305,LOC107720223,LOC107703259 other upstream 2284273 19175463 ~ 19183978 (-)
kcnt1b LOC107720246,LOC107699766,LOC107672542 other upstream 2973829 19865019 ~ 19935576 (-)
G38058 NA other upstream 3160469 20051659 ~ 20055798 (-)
G38140 si:ch211-236k19.4,LOC107552622,LOC107740829,LOC107699705,LOC107731026,LOC107672535,LOC107587659 other upstream 3234399 20125589 ~ 20127390 (-)

Expression


Co-expression Network