G37453 (adgrv1,LOC107669515,LOC107660972)


Basic Information

Item Value
gene id G37453
gene name adgrv1,LOC107669515,LOC107660972
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056703.1
NCBI id CM032072.1
chromosome length 32833783
location 17946547 ~ 17946764 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU55274
CCACTCTAGCGGTCAATGGAACTGCTCTGAACTTGACAGACACATCAGCAAAAATCCCTCCAATACGCGTTACATTGATTATAGGTCCAACGTAGTACTCGTGCACACTCACTGCTGGGGAAGACAGTTGTAGCAACCCAAAAGCATCGTCGCTGGCCTCTATAATGATTTGGGCAACTGTGACATTCCGTGGGCCAAGTCGAGGGGAAAGAGCGACT

Function

symbol description
adgrv1 Predicted to enable G protein-coupled receptor activity; G-protein alpha-subunit binding activity; and adenylate cyclase inhibitor activity. Acts upstream of or within eye photoreceptor cell development. Predicted to be located in photoreceptor inner segment and stereocilium membrane. Predicted to be integral component of membrane. Is expressed in integument; nervous system; and pleuroperitoneal region. Human ortholog(s) of this gene implicated in Usher syndrome type 2C and familial febrile seizures 4. Orthologous to human ADGRV1 (adhesion G protein-coupled receptor V1).

NR:

description
PREDICTED: LOW QUALITY PROTEIN: G-protein coupled receptor 98-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU55274 True 218 lncRNA 0.50 1 17946547 17946764

Neighbor

gene id symbol gene type direction distance location
lysmd3 lysmd3,LOC107720182,LOC107660979,LOC107553928,LOC107756288,LOC107669503 coding downstream 42212 17899764 ~ 17904335 (-)
mblac2 mblac2,LOC107669518,LOC107720183,LOC107753186 coding downstream 50614 17893508 ~ 17895933 (-)
mef2cb mef2cb,mef2c,LOC107720185 coding downstream 190781 17686501 ~ 17755766 (-)
tmem161b tmem161b,LOC107720188,LOC107660970,LOC107669514,LOC107753179,LOC107553926 coding downstream 314385 17616213 ~ 17632162 (-)
ccnh ccnh,LOC107753181,LOC107553924,LOC107720191,LOC107660965 coding downstream 354190 17586823 ~ 17592357 (-)
arrdc3a arrdc3a,LOC107720180,LOC107660973,LOC107669509,LOC107756289,LOC103032997,LOC108426240 coding upstream 80457 18027221 ~ 18034972 (-)
LOC122344755 LOC107575123,LOC107720179 coding upstream 90823 18037587 ~ 18042062 (-)
LOC122345814 LOC107567414,LOC107756269,LOC107699689,LOC107575123,LOC107720179,LOC107720216 coding upstream 96750 18043514 ~ 18046387 (-)
fam172a fam172a,LOC107720296,LOC107703201,LOC107756291 coding upstream 439209 18385973 ~ 18534507 (-)
kiaa0825 kiaa0825,LOC107720295,LOC107699712,LOC107587549,LOC107756295,LOC107703244 coding upstream 588841 18535605 ~ 18648678 (-)
G37439 NA non-coding downstream 53229 17891957 ~ 17893318 (-)
G37427 NA non-coding downstream 254402 17668259 ~ 17692145 (-)
LOC122345155 NA non-coding downstream 260523 17646096 ~ 17686024 (-)
G37363 NA non-coding downstream 594137 17351315 ~ 17352410 (-)
G37340 NA non-coding downstream 781395 17162677 ~ 17165152 (-)
G37455 adgrv1,LOC107660972,LOC107669515 non-coding upstream 7736 17954500 ~ 17954747 (-)
G37456 NA non-coding upstream 8787 17955551 ~ 17955769 (-)
G37458 adgrv1,LOC107660972,LOC107669515 non-coding upstream 15079 17961843 ~ 17962070 (-)
G37459 adgrv1,LOC107660972,LOC107669515 non-coding upstream 16940 17963704 ~ 17963934 (-)
G37460 NA non-coding upstream 17620 17964384 ~ 17965101 (-)
LOC122344738 acsl1b,LOC107571490,LOC107678619,LOC107758469,LOC107552354,LOC108274927 other downstream 596167 17346469 ~ 17350380 (-)
LOC122345693 NA other downstream 1086616 16787809 ~ 16859931 (-)
G37277 ncam1a,LOC107681081,LOC107548183,LOC107756101 other downstream 1233380 16687260 ~ 16713167 (-)
G37258 ncor2,LOC107687981,LOC107684513,LOC107753125 other downstream 1313426 16596855 ~ 16633121 (-)
LOC122344728 uprt,LOC107733222,LOC107672530,LOC107680369,LOC107748634 other downstream 1568032 16376266 ~ 16378515 (-)
mtx3 cmya5,mtx3,LOC107699728,LOC107703257,LOC107720274,LOC107756304,LOC107555495,LOC107756305,LOC107720223,LOC107703259 other upstream 1228699 19175463 ~ 19183978 (-)
kcnt1b LOC107720246,LOC107699766,LOC107672542 other upstream 1918255 19865019 ~ 19935576 (-)
G38058 NA other upstream 2104895 20051659 ~ 20055798 (-)
G38140 si:ch211-236k19.4,LOC107552622,LOC107740829,LOC107699705,LOC107731026,LOC107672535,LOC107587659 other upstream 2178825 20125589 ~ 20127390 (-)
LOC122345844 ppil3 other upstream 2447967 20394731 ~ 20396734 (-)

Expression


Co-expression Network