G37461 (adgrv1,LOC107660972,LOC107669515)


Basic Information

Item Value
gene id G37461
gene name adgrv1,LOC107660972,LOC107669515
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056703.1
NCBI id CM032072.1
chromosome length 32833783
location 17966299 ~ 17967103 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU55282
CAGAATAATGATTTTGGCAAATGAAGTGAATCCCAGTTCATCTGGCATGCTGACAATCTGTGCTCCACCTTCTGCTTCGGTGAGGTAGATAAAGAACGCCTCCTGTCCCTCCGGCTCCTGATCATTCAGTATTAGGACGCTGACCTCCACCTCATTCTGTCCCTCCAATAGTGTGACAGTTTGGGTCTCCAAGGCAAAGTCTTCTCCTTCCAGGGCCCATGTGCCATTATACTCCCGGTGAAACTGGGCTGCATTCACCTCCGGGGTTCTAAGTCCTGCATAGGCTCTGATTTTGGCACTCACCACTCCTGTGAGCCCTGCCGACCTGCGTACTCTCAAAGCAAGCTTCTGTTGGGGCGCACCCTCCTGACTGTCTTCAGAAATCTGTATTATTGCTGGCCCTATACTTAAAAACCCACTAACCACATCGTTAGCACGGATGGTAATTTTAGCGACGCTATTTTTAGCCACAATGAGAGGCTGAACTTCGATTGAAGGCAAACTGGCACTGAGAACACGGACGCTGGTTAAGTTCAAGTAAAAATCCTCGTCTGGTTCAGTTAGGGAATCGTCAAGAATAGACAAGCGAATGGCAGCAGATGTTTGGCGGGAATCAAATGGAAGCTGGCCGTCTGCTACCGATGCAAAGTCCTTGTCAGGCTGAGCAGAGCCAGGCCATGTCTTGTAGGAAATGCTGGAACGGTTGCTGCGGAAGCCATAGAGGCGCTGGACGTAGAGGGTGATGGTCTGTACGTCCTCCTCAATCACAAGCTGTCGAGAATCAGGACGAAACTGATATAATCCT

Function

symbol description
adgrv1 Predicted to enable G protein-coupled receptor activity; G-protein alpha-subunit binding activity; and adenylate cyclase inhibitor activity. Acts upstream of or within eye photoreceptor cell development. Predicted to be located in photoreceptor inner segment and stereocilium membrane. Predicted to be integral component of membrane. Is expressed in integument; nervous system; and pleuroperitoneal region. Human ortholog(s) of this gene implicated in Usher syndrome type 2C and familial febrile seizures 4. Orthologous to human ADGRV1 (adhesion G protein-coupled receptor V1).

NR:

description
PREDICTED: G-protein coupled receptor 98

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU55282 True 805 lncRNA 0.50 1 17966299 17967103

Neighbor

gene id symbol gene type direction distance location
lysmd3 lysmd3,LOC107720182,LOC107660979,LOC107553928,LOC107756288,LOC107669503 coding downstream 61964 17899764 ~ 17904335 (-)
mblac2 mblac2,LOC107669518,LOC107720183,LOC107753186 coding downstream 70366 17893508 ~ 17895933 (-)
mef2cb mef2cb,mef2c,LOC107720185 coding downstream 210533 17686501 ~ 17755766 (-)
tmem161b tmem161b,LOC107720188,LOC107660970,LOC107669514,LOC107753179,LOC107553926 coding downstream 334137 17616213 ~ 17632162 (-)
ccnh ccnh,LOC107753181,LOC107553924,LOC107720191,LOC107660965 coding downstream 373942 17586823 ~ 17592357 (-)
arrdc3a arrdc3a,LOC107720180,LOC107660973,LOC107669509,LOC107756289,LOC103032997,LOC108426240 coding upstream 60118 18027221 ~ 18034972 (-)
LOC122344755 LOC107575123,LOC107720179 coding upstream 70484 18037587 ~ 18042062 (-)
LOC122345814 LOC107567414,LOC107756269,LOC107699689,LOC107575123,LOC107720179,LOC107720216 coding upstream 76411 18043514 ~ 18046387 (-)
fam172a fam172a,LOC107720296,LOC107703201,LOC107756291 coding upstream 418870 18385973 ~ 18534507 (-)
kiaa0825 kiaa0825,LOC107720295,LOC107699712,LOC107587549,LOC107756295,LOC107703244 coding upstream 568502 18535605 ~ 18648678 (-)
G37460 NA non-coding downstream 1198 17964384 ~ 17965101 (-)
G37459 adgrv1,LOC107660972,LOC107669515 non-coding downstream 2365 17963704 ~ 17963934 (-)
G37458 adgrv1,LOC107660972,LOC107669515 non-coding downstream 4229 17961843 ~ 17962070 (-)
G37456 NA non-coding downstream 10530 17955551 ~ 17955769 (-)
G37455 adgrv1,LOC107660972,LOC107669515 non-coding downstream 11552 17954500 ~ 17954747 (-)
G37462 adgrv1,LOC107660972,LOC107669515 non-coding upstream 1257 17968360 ~ 17968602 (-)
G37463 adgrv1,LOC107669515,LOC107660972 non-coding upstream 3115 17970218 ~ 17970616 (-)
G37464 adgrv1,LOC107660972,LOC107669515 non-coding upstream 5075 17972178 ~ 17972581 (-)
G37465 NA non-coding upstream 6684 17973787 ~ 17974258 (-)
G37469 NA non-coding upstream 38467 18005570 ~ 18006634 (-)
LOC122344738 acsl1b,LOC107571490,LOC107678619,LOC107758469,LOC107552354,LOC108274927 other downstream 615919 17346469 ~ 17350380 (-)
LOC122345693 NA other downstream 1106368 16787809 ~ 16859931 (-)
G37277 ncam1a,LOC107681081,LOC107548183,LOC107756101 other downstream 1253132 16687260 ~ 16713167 (-)
G37258 ncor2,LOC107687981,LOC107684513,LOC107753125 other downstream 1333178 16596855 ~ 16633121 (-)
LOC122344728 uprt,LOC107733222,LOC107672530,LOC107680369,LOC107748634 other downstream 1587784 16376266 ~ 16378515 (-)
mtx3 cmya5,mtx3,LOC107699728,LOC107703257,LOC107720274,LOC107756304,LOC107555495,LOC107756305,LOC107720223,LOC107703259 other upstream 1208360 19175463 ~ 19183978 (-)
kcnt1b LOC107720246,LOC107699766,LOC107672542 other upstream 1897916 19865019 ~ 19935576 (-)
G38058 NA other upstream 2084556 20051659 ~ 20055798 (-)
G38140 si:ch211-236k19.4,LOC107552622,LOC107740829,LOC107699705,LOC107731026,LOC107672535,LOC107587659 other upstream 2158486 20125589 ~ 20127390 (-)
LOC122345844 ppil3 other upstream 2427628 20394731 ~ 20396734 (-)

Expression


Co-expression Network