G37463 (adgrv1,LOC107669515,LOC107660972)


Basic Information

Item Value
gene id G37463
gene name adgrv1,LOC107669515,LOC107660972
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056703.1
NCBI id CM032072.1
chromosome length 32833783
location 17970218 ~ 17970616 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU55284
TGCATCAAACACAGCAGTTAGCTGCTCTGGAGTGATGTCCTTACTAACTTTATTGATAAGCCCTTGAAGGACCCGATTGATGATGGTCTCATCCAGAGGCTGATGTAACTGGTCCAGCAGGGCCCATACTGCCTGAGCCTCTGAGTCTGAAACCAGGGTGATGTTAGCCAGCCCGAATTCTGGGTGAACCCTTGCACCACCGGTGGCGTCAGAGAGAGCTACGCGGAAGCGTTTAGGTGTTGGGTTGGAAGAACCGATGTTCGGTGTGAGGGACACATCCAGCCCGGCACTTCTCTGTCCGATTTCAAAAGTCAGGGTGCCCTCTGCCAGGACAAAGTCCTGCCCTGCCACGGCAGGCCAGATTAGAGTGGGTCCAATAGACTCTGCTTTCGGAAGCTC

Function

symbol description
adgrv1 Predicted to enable G protein-coupled receptor activity; G-protein alpha-subunit binding activity; and adenylate cyclase inhibitor activity. Acts upstream of or within eye photoreceptor cell development. Predicted to be located in photoreceptor inner segment and stereocilium membrane. Predicted to be integral component of membrane. Is expressed in integument; nervous system; and pleuroperitoneal region. Human ortholog(s) of this gene implicated in Usher syndrome type 2C and familial febrile seizures 4. Orthologous to human ADGRV1 (adhesion G protein-coupled receptor V1).

NR:

description
PREDICTED: G-protein coupled receptor 98

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU55284 True 399 lncRNA 0.54 1 17970218 17970616

Neighbor

gene id symbol gene type direction distance location
lysmd3 lysmd3,LOC107720182,LOC107660979,LOC107553928,LOC107756288,LOC107669503 coding downstream 65883 17899764 ~ 17904335 (-)
mblac2 mblac2,LOC107669518,LOC107720183,LOC107753186 coding downstream 74285 17893508 ~ 17895933 (-)
mef2cb mef2cb,mef2c,LOC107720185 coding downstream 214452 17686501 ~ 17755766 (-)
tmem161b tmem161b,LOC107720188,LOC107660970,LOC107669514,LOC107753179,LOC107553926 coding downstream 338056 17616213 ~ 17632162 (-)
ccnh ccnh,LOC107753181,LOC107553924,LOC107720191,LOC107660965 coding downstream 377861 17586823 ~ 17592357 (-)
arrdc3a arrdc3a,LOC107720180,LOC107660973,LOC107669509,LOC107756289,LOC103032997,LOC108426240 coding upstream 56605 18027221 ~ 18034972 (-)
LOC122344755 LOC107575123,LOC107720179 coding upstream 66971 18037587 ~ 18042062 (-)
LOC122345814 LOC107567414,LOC107756269,LOC107699689,LOC107575123,LOC107720179,LOC107720216 coding upstream 72898 18043514 ~ 18046387 (-)
fam172a fam172a,LOC107720296,LOC107703201,LOC107756291 coding upstream 415357 18385973 ~ 18534507 (-)
kiaa0825 kiaa0825,LOC107720295,LOC107699712,LOC107587549,LOC107756295,LOC107703244 coding upstream 564989 18535605 ~ 18648678 (-)
G37462 adgrv1,LOC107660972,LOC107669515 non-coding downstream 1616 17968360 ~ 17968602 (-)
G37461 adgrv1,LOC107660972,LOC107669515 non-coding downstream 3115 17966299 ~ 17967103 (-)
G37460 NA non-coding downstream 5117 17964384 ~ 17965101 (-)
G37459 adgrv1,LOC107660972,LOC107669515 non-coding downstream 6284 17963704 ~ 17963934 (-)
G37458 adgrv1,LOC107660972,LOC107669515 non-coding downstream 8148 17961843 ~ 17962070 (-)
G37464 adgrv1,LOC107660972,LOC107669515 non-coding upstream 1562 17972178 ~ 17972581 (-)
G37465 NA non-coding upstream 3171 17973787 ~ 17974258 (-)
G37469 NA non-coding upstream 34954 18005570 ~ 18006634 (-)
G37471 adgrv1,LOC107660972,LOC107669515 non-coding upstream 38899 18009515 ~ 18010277 (-)
G37470 NA non-coding upstream 41775 18012391 ~ 18012788 (-)
LOC122344738 acsl1b,LOC107571490,LOC107678619,LOC107758469,LOC107552354,LOC108274927 other downstream 619838 17346469 ~ 17350380 (-)
LOC122345693 NA other downstream 1110287 16787809 ~ 16859931 (-)
G37277 ncam1a,LOC107681081,LOC107548183,LOC107756101 other downstream 1257051 16687260 ~ 16713167 (-)
G37258 ncor2,LOC107687981,LOC107684513,LOC107753125 other downstream 1337097 16596855 ~ 16633121 (-)
LOC122344728 uprt,LOC107733222,LOC107672530,LOC107680369,LOC107748634 other downstream 1591703 16376266 ~ 16378515 (-)
mtx3 cmya5,mtx3,LOC107699728,LOC107703257,LOC107720274,LOC107756304,LOC107555495,LOC107756305,LOC107720223,LOC107703259 other upstream 1204847 19175463 ~ 19183978 (-)
kcnt1b LOC107720246,LOC107699766,LOC107672542 other upstream 1894403 19865019 ~ 19935576 (-)
G38058 NA other upstream 2081043 20051659 ~ 20055798 (-)
G38140 si:ch211-236k19.4,LOC107552622,LOC107740829,LOC107699705,LOC107731026,LOC107672535,LOC107587659 other upstream 2154973 20125589 ~ 20127390 (-)
LOC122345844 ppil3 other upstream 2424115 20394731 ~ 20396734 (-)

Expression


Co-expression Network