G38658 (nup88,LOC107691763,LOC107709758,LOC107600765,LOC107744326,LOC107664301)


Basic Information

Item Value
gene id G38658
gene name nup88,LOC107691763,LOC107709758,LOC107600765,LOC107744326,LOC107664301
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056703.1
NCBI id CM032072.1
chromosome length 32833783
location 22873971 ~ 22876437 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU57216
TGCAGTTGATCTGGATGCGTCCGCCCTCGAACTCTGACCTCTTGCCCCAGCGCTGAGGCAGCTCCAGTATAGTCGCTCCACGCTGACCGATGAGAGCCACATGATACTGCGTCGGGCTGACCAGCACCTGACACACCTCAAACAGCGGCGGGTTGATGCACAGCAGAGTCTGCGGAGGGTTGCGGACACACAGTCAGCGAAATAACTACACCCGGCAGACTCTATCTAAACACACTAACCTGGTATTTAGAAGTGTCCGTGTCGCCGTCCGTGTTCAACTGTCGCAGGTTTGTGGTGTAAAACACGCTCTCAACACTATCCCATACGAATAAGTCACCGTTCAGACAAAACGTAAGGTTCTTTGTTATTCTTTTGCTTGTCCCCTGAGGCTCTAAATGAAGCCTTTCTTTTAGTTTAATGAAGATATCGTGGTTTTTTAGCGCGTCCCTCCAGCGATCTCCCGCGAACGACGCCATGTTGTTCTGTGTTGTCAC

Function

symbol description
nup88 Predicted to be a structural constituent of nuclear pore. Predicted to act upstream of or within mRNA transport; protein transport; and ribosomal subunit export from nucleus. Predicted to be located in nucleus. Predicted to be part of nuclear pore. Is expressed in several structures, including brain; eye; immature eye; otic vesicle; and yolk syncytial layer. Human ortholog(s) of this gene implicated in fetal akinesia deformation sequence syndrome 4. Orthologous to human NUP88 (nucleoporin 88).

NR:

description
PREDICTED: nuclear pore complex protein Nup88-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU57216 True 494 lncRNA 0.51 2 22873971 22876437

Neighbor

gene id symbol gene type direction distance location
prkrip1 prkrip1,LOC107691809,LOC107600793,LOC107689383 coding downstream 38648 22832643 ~ 22835323 (-)
upk3b LOC107691810,LOC107709747,LOC107600792 coding downstream 42237 22826309 ~ 22831734 (-)
rasa4 rasa4,LOC107691765,LOC107709756,LOC107744328,LOC107561580,LOC107689382,LOC107600782,LOC108260369,LOC108428505 coding downstream 50105 22793505 ~ 22823866 (-)
clip2 clip2,LOC107709754,LOC107744329 coding downstream 83164 22761711 ~ 22790807 (-)
gtf2ird1 gtf2ird1,LOC107600764,LOC107709753 coding downstream 114193 22738083 ~ 22759778 (-)
rabep1 rabep1,LOC107691762,LOC107664300 coding upstream 6918 22883355 ~ 22900893 (-)
derl2 derl2,LOC107664304,LOC107744323 coding upstream 30464 22906901 ~ 22910871 (-)
cenatac LOC107712938,LOC107600772,LOC107691808,LOC107664297,LOC107556429 coding upstream 168965 23045402 ~ 23049958 (-)
foxr1 zgc:171734,LOC107712932,LOC107691807,LOC107600773 coding upstream 174499 23050936 ~ 23054269 (-)
zgc:194948 NA coding upstream 178509 23054946 ~ 23056425 (-)
G38634 NA non-coding downstream 80918 22791690 ~ 22793053 (-)
LOC122344815 NA non-coding downstream 832704 22038360 ~ 22041267 (-)
LOC122346224 NA non-coding downstream 833937 22039901 ~ 22040034 (-)
G38543 NA non-coding downstream 863864 22008886 ~ 22010107 (-)
G38523 NA non-coding downstream 997386 21867615 ~ 21876585 (-)
G38747 NA non-coding upstream 160020 23036457 ~ 23037470 (-)
G38767 NA non-coding upstream 469152 23345589 ~ 23345797 (-)
G38769 NA non-coding upstream 481137 23357574 ~ 23358147 (-)
G38892 NA non-coding upstream 790404 23666841 ~ 23669869 (-)
G38982 NA non-coding upstream 1026182 23902619 ~ 23902898 (-)
LOC122344823 LOC107717639,LOC107712133,LOC107685828,LOC107710712,LOC107681889,LOC107575606,LOC107587718 other downstream 989949 21877081 ~ 21884022 (-)
akap10 akap10,LOC107595480,LOC107587677 other downstream 1047866 21809013 ~ 21826105 (-)
G38355 abr,LOC107665039,LOC107595513,LOC107712163 other downstream 1254388 21612688 ~ 21619583 (-)
G38359 NA other downstream 1504923 21364238 ~ 21369048 (-)
LOC122345723 LOC107665045,LOC107595503,LOC107688632,LOC107731048,LOC107740809,LOC107740824 other downstream 1937874 20906043 ~ 20936097 (-)
nrgna nrgna other upstream 250775 23127212 ~ 23132008 (-)
LOC122345364 NA other upstream 725799 23602236 ~ 23605748 (-)
G38917 LOC107691721,LOC107751254,LOC107564048,LOC107721650,LOC107603186,LOC107663788 other upstream 875443 23751880 ~ 23756588 (-)
G38973 NA other upstream 1010866 23887303 ~ 23887680 (-)
aatf LOC107695156,LOC107730321,LOC107600606,LOC107603183 other upstream 1103227 23979664 ~ 23997739 (-)

Expression


Co-expression Network