G39120


Basic Information

Item Value
gene id G39120
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056703.1
NCBI id CM032072.1
chromosome length 32833783
location 24212442 ~ 24212759 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU57919
TAAAAGCAAAAGTTTCAGTTGTCGGGATGAATCCCGTTTGTCCATCTTAAGCTGTCTCTCAATTTCCTGGTGAATCCTGAAGCTTTCTCTGTCTTCACTCGACAAGCAGCAGTCCCCCATCCTGAACAGCTTGAACCTTCTCCAGTACTTAGCAGTTAACACATTCATCAGTCACTCACCAGTGTTAAAAACCCTTCTTTAAGAAAGCCTATTGAAACACGCCTACATCAGGACTAGCCTGATGTACTGTAATTTATAGTTTCTTCCTTGTTCAATCGATGGGTTGGGTTGTGTCACATAAGGCATTAGTTTCCTTTT

Function

GO:

id name namespace
GO:0009615 response to virus biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU57919 True 318 lncRNA 0.42 1 24212442 24212759

Neighbor

gene id symbol gene type direction distance location
ntrk2b ntrk2b,LOC107691713,LOC107728215,LOC107600581,LOC107730333,LOC107596017,LOC108443857,LOC103044160,LOC108259739,LOC107684341 coding downstream 24957 24166208 ~ 24187485 (-)
tmem150ab tmem150ab,LOC107684378,LOC107600579,LOC107572579,LOC107728219,LOC107691718 coding downstream 114268 24092380 ~ 24098174 (-)
fkbp6 fkbp6,LOC107695148,LOC107600609,LOC107691791,LOC107728208,LOC103911693,LOC107730305 coding downstream 125938 24082446 ~ 24086504 (-)
fzd9a LOC107600608,LOC107728207,LOC107691792,LOC107695150,LOC107572577,LOC107730317 coding downstream 139579 24070279 ~ 24072863 (-)
mrm1 mrm1,LOC107695155,LOC107603181,LOC107730354 coding downstream 169705 24039706 ~ 24042737 (-)
pcsk5a pcsk5a,LOC107728213,LOC107691788,LOC107684380,LOC107730328,LOC107596014,LOC107600598 coding upstream 17587 24230346 ~ 24252631 (-)
LOC122345102 LOC107691787,LOC107600611,LOC107684345,LOC107595997,LOC107684346 coding upstream 40574 24253333 ~ 24264718 (-)
LOC122345313 LOC107681049,LOC107706956,LOC107574963 coding upstream 85771 24298530 ~ 24317831 (-)
cd180 LOC107742410,LOC107681052,LOC107600612 coding upstream 194236 24406995 ~ 24409513 (-)
pmchl LOC107683707,LOC107575048,LOC107738923,LOC107596031,LOC107730319,LOC107684382 coding upstream 317649 24530408 ~ 24530963 (-)
G39059 NA non-coding downstream 105179 24101841 ~ 24107263 (-)
G39057 NA non-coding downstream 123630 24087880 ~ 24088812 (-)
G39050 NA non-coding downstream 142528 24068630 ~ 24069914 (-)
G39034 NA non-coding downstream 233915 23977176 ~ 23978527 (-)
G38982 NA non-coding downstream 309544 23902619 ~ 23902898 (-)
G39121 NA non-coding upstream 1767 24214526 ~ 24215160 (-)
G39122 NA non-coding upstream 5341 24218100 ~ 24218430 (-)
G39123 NA non-coding upstream 6234 24218993 ~ 24219527 (-)
G39137 NA non-coding upstream 64715 24277474 ~ 24280889 (-)
G39274 NA non-coding upstream 202141 24414900 ~ 24490792 (-)
G39113 NA other downstream 11946 24197705 ~ 24200496 (-)
aatf LOC107695156,LOC107730321,LOC107600606,LOC107603183 other downstream 214703 23979664 ~ 23997739 (-)
G38973 NA other downstream 324762 23887303 ~ 23887680 (-)
G38917 LOC107691721,LOC107751254,LOC107564048,LOC107721650,LOC107603186,LOC107663788 other downstream 455854 23751880 ~ 23756588 (-)
LOC122345364 NA other downstream 606694 23602236 ~ 23605748 (-)
tmc2a tmc2a,tmc1,LOC107684381,LOC107596032,LOC108437175,LOC107730318,LOC108259782 other upstream 52705 24265464 ~ 24277304 (-)
anapc2 anapc2,LOC107559737,LOC107730340,LOC107746468,LOC107683706,LOC107595991,LOC107684355 other upstream 374965 24587724 ~ 24594116 (-)
naa38 naa38 other upstream 533913 24746672 ~ 24748610 (-)
LOC122345923 NA other upstream 541443 24754202 ~ 24758668 (-)
G39413 LOC102215562 other upstream 1069127 25281886 ~ 25282286 (-)

Expression


Co-expression Network