G39872


Basic Information

Item Value
gene id G39872
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056703.1
NCBI id CM032072.1
chromosome length 32833783
location 27232658 ~ 27234162 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU59023
GAAAACTAACCCGGTGTGGATGGGGCTTGCTACTGGACTGACATTGTCTGATGTCTCTGTGGCCGGACTGCTGGGGATCAGCGAATCCTCATCGTACTCTTTGGGCAATTCCTCAGTTTGGGCTCTGATCTTTTCTTTTCAATCTAGCTTGAAACATTCTAGTTAATTTCTTCCAGCAGCATTATGAGTTTAGCTCCCCTCTACTTTATACATGTGTCTCGTCTGGTTAAATCTGAACCATCTTCAACATCATCACTGCAACTCTCCCTCGTACTCTAGAACATTCTTGGGGGAAAGGAAATCCTCATCATGGTCCTTTAAGTCGTCCATCTTCAAATACCTGGCACCTTCGTTCCCCAGCAGCTCCTCGC

Function

GO:

id name namespace
GO:0019825 oxygen binding molecular_function
GO:0004852 uroporphyrinogen-III synthase activity molecular_function

KEGG:

id description
ko00860 Porphyrin and chlorophyll metabolism

RNA

RNA id representative length rna type GC content exon number start site end site
TU59023 True 371 lncRNA 0.46 2 27232658 27234162

Neighbor

gene id symbol gene type direction distance location
LOC122344788 LOC107548517,LOC107662059 coding downstream 59764 27168265 ~ 27172894 (-)
LOC122345424 klhl34,LOC107586735,LOC107671349,LOC107705277,LOC107721877,LOC107663667,LOC107590345 coding downstream 132939 27095380 ~ 27099719 (-)
LOC122345427 LOC107721568,LOC107697698,LOC107711701,LOC107654838,LOC108438743 coding downstream 218160 27001647 ~ 27014498 (-)
LOC122345425 rps6ka4,LOC107758164,LOC107698546,LOC107567284,LOC107702937,LOC108427766 coding downstream 231398 26997549 ~ 27001260 (-)
unga ung,unga,LOC107712535,LOC107687060,LOC107560323,LOC107752258,LOC107702903 coding downstream 330984 26897463 ~ 26901674 (-)
spaw LOC107548501,LOC107662086,LOC107740019 coding upstream 42885 27277047 ~ 27280391 (-)
usp39 usp39,LOC107662055,LOC107739996,LOC107702962,LOC107722749 coding upstream 54010 27288172 ~ 27293486 (-)
mat2ab mat2ab,LOC107548521,LOC107662054,LOC107739995,LOC107556049,LOC107722750,LOC107702964,LOC106580346 coding upstream 68097 27302259 ~ 27308208 (-)
inpp5jb LOC107739994,LOC107548522,LOC107702965,LOC107662051,LOC107556011,LOC106585266 coding upstream 78727 27312889 ~ 27334798 (-)
smtnb smtn,LOC107739992,LOC107662053,LOC107702966 coding upstream 109328 27343490 ~ 27389998 (-)
G39870 NA non-coding downstream 7096 27224887 ~ 27225562 (-)
G39857 NA non-coding downstream 43436 27188850 ~ 27189222 (-)
LOC122344810 LOC107662059,LOC107548517 non-coding downstream 85696 27115967 ~ 27146962 (-)
LOC122344808 LOC107671984 non-coding downstream 90000 27140415 ~ 27142658 (-)
LOC122344809 LOC107671984 non-coding downstream 104202 27127129 ~ 27128456 (-)
G39888 NA non-coding upstream 31127 27265289 ~ 27267229 (-)
G39893 NA non-coding upstream 51020 27285182 ~ 27286194 (-)
G39935 NA non-coding upstream 304326 27538488 ~ 27538861 (-)
G39936 NA non-coding upstream 304778 27538940 ~ 27539327 (-)
G39951 rgs3a,LOC107702900,LOC107728018,LOC107556028,LOC107558862,LOC107693410 non-coding upstream 416288 27650450 ~ 27650827 (-)
LOC122345426 smpx,LOC107705278,LOC107671350,LOC107590224,LOC107663668,LOC107586736,LOC107721880 other downstream 125273 27099815 ~ 27107385 (-)
LOC122344921 NA other downstream 1663972 25561974 ~ 25568686 (-)
G39413 LOC102215562 other downstream 1950372 25281886 ~ 25282286 (-)
LOC122345923 NA other downstream 2473990 24754202 ~ 24758668 (-)
naa38 naa38 other downstream 2484048 24746672 ~ 24748610 (-)
isca1 isca1,LOC107702919,LOC107662049 other upstream 148759 27382921 ~ 27398741 (-)
LOC122344874 NA other upstream 651879 27886041 ~ 27895454 (-)
G40080 pappaa,pappa,LOC107556005,LOC107558864,LOC107739977,LOC107675511,LOC107728218 other upstream 1021666 28255828 ~ 28264704 (-)
LOC122345120 LOC107728794,LOC107696375,LOC107590009,LOC107739482 other upstream 2089820 29323982 ~ 29326115 (-)
G40182 brinp1,LOC107715673,LOC107674904 other upstream 2226423 29460585 ~ 29490204 (-)

Expression


Co-expression Network