G39951 (rgs3a,LOC107702900,LOC107728018,LOC107556028,LOC107558862,LOC107693410)


Basic Information

Item Value
gene id G39951
gene name rgs3a,LOC107702900,LOC107728018,LOC107556028,LOC107558862,LOC107693410
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056703.1
NCBI id CM032072.1
chromosome length 32833783
location 27650450 ~ 27650827 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU59154
CTGGCTTCCAGGGTTAATAGGTGACAGGATGATATAATTGTCTCCGTTCGATGCTTTCACGCGTGTCCCTCTAAGTGTCTGAGTGCTTGTCTTGCCATCTACCGCAGTCCTCCGTTCTCCCCACAGGATTCCCGCTGCACTCCCTCCTCCTCCCACTCCCTCTGAGCCGTTGACTACAGTTCTACGGCTGGTGTGGTGATGTGCGGGCAGAGGCGGAAGCGGTGGTGTTTTGTCGGCCCTCTTTGCTTTCGCTGGGGAAACTGGAGTGTCATAGTTAGAAGACTTGTAAGAAGGGTGATGGATCAACCCCTCGAAATTGGTCTTGACAGAAGGTCCTGTACGCCAGACTACCACTGTGATCTCACTAAGACTATTTCT

Function

symbol description
rgs3a Acts upstream of or within negative regulation of Wnt signaling pathway, calcium modulating pathway and somite development. Is expressed in brain; somite; and tail bud. Orthologous to human RGS3 (regulator of G protein signaling 3).

NR:

description
PREDICTED: regulator of G-protein signaling 3-like, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU59154 True 378 lncRNA 0.53 1 27650450 27650827

Neighbor

gene id symbol gene type direction distance location
LOC122346185 ugt2a4,ugt2a3,ugt2a1,LOC107548539,LOC107728043,LOC107556031,LOC107702978,LOC107728060,LOC107702979,LOC107693409,LOC107739983 coding downstream 34994 27605812 ~ 27615456 (-)
LOC122345116 ugt2a3,LOC107728060,LOC107702979,LOC107556030,LOC107728043,LOC107556031,LOC107702978,LOC107548539 coding downstream 46041 27593593 ~ 27604409 (-)
ythdc1 ythdc1,LOC107693408,LOC107702977,LOC107728241 coding downstream 60540 27575738 ~ 27589910 (-)
rilpl2 rilpl2,LOC107728107,LOC107702927 coding downstream 105200 27542420 ~ 27545250 (-)
mob1a LOC107739988,LOC107675956,LOC107702973,LOC101160416,LOC103363194,LOC107087288,LOC103031464,LOC101481896 coding downstream 125036 27522065 ~ 27525414 (-)
LOC122344872 NA coding upstream 259400 27910227 ~ 27914589 (-)
LOC122346138 astn2,LOC107675510,LOC107683760,LOC106563268,LOC106565912 coding upstream 686574 28337401 ~ 28683169 (-)
LOC122344834 LOC108430399,LOC107568487,LOC105913012,LOC103355419 coding upstream 1292914 28943741 ~ 28944764 (-)
brinp1 brinp1 coding upstream 1524124 29174951 ~ 29270700 (-)
LOC122345544 ubr2,LOC107669566,LOC107696377 coding upstream 1652316 29303143 ~ 29323685 (-)
G39936 NA non-coding downstream 111123 27538940 ~ 27539327 (-)
G39935 NA non-coding downstream 111589 27538488 ~ 27538861 (-)
G39893 NA non-coding downstream 364256 27285182 ~ 27286194 (-)
G39888 NA non-coding downstream 383221 27265289 ~ 27267229 (-)
G39872 NA non-coding downstream 416288 27232658 ~ 27234162 (-)
G39964 NA non-coding upstream 97633 27748460 ~ 27789829 (-)
G40021 NA non-coding upstream 244816 27895643 ~ 27895961 (-)
G40057 NA non-coding upstream 529381 28180208 ~ 28180575 (-)
G40058 NA non-coding upstream 529797 28180624 ~ 28180999 (-)
G40074 pappaa,LOC107558864,LOC107675511,LOC107739977,LOC107728218,LOC107556005 non-coding upstream 591834 28242661 ~ 28243655 (-)
isca1 isca1,LOC107702919,LOC107662049 other downstream 251709 27382921 ~ 27398741 (-)
LOC122345426 smpx,LOC107705278,LOC107671350,LOC107590224,LOC107663668,LOC107586736,LOC107721880 other downstream 543065 27099815 ~ 27107385 (-)
LOC122344921 NA other downstream 2081764 25561974 ~ 25568686 (-)
G39413 LOC102215562 other downstream 2368164 25281886 ~ 25282286 (-)
LOC122345923 NA other downstream 2891782 24754202 ~ 24758668 (-)
LOC122344874 NA other upstream 235214 27886041 ~ 27895454 (-)
G40080 pappaa,pappa,LOC107556005,LOC107558864,LOC107739977,LOC107675511,LOC107728218 other upstream 605001 28255828 ~ 28264704 (-)
LOC122345120 LOC107728794,LOC107696375,LOC107590009,LOC107739482 other upstream 1673155 29323982 ~ 29326115 (-)
G40182 brinp1,LOC107715673,LOC107674904 other upstream 1809758 29460585 ~ 29490204 (-)
eng LOC107562335,LOC107704777,LOC107741503 other upstream 1963892 29614719 ~ 29655061 (-)

Expression


Co-expression Network