G40079 (pappaa,LOC107739977,LOC107558864,LOC107675511,LOC107556005,LOC107728218)


Basic Information

Item Value
gene id G40079
gene name pappaa,LOC107739977,LOC107558864,LOC107675511,LOC107556005,LOC107728218
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056703.1
NCBI id CM032072.1
chromosome length 32833783
location 28254921 ~ 28255207 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU59333
GCGTAACTCATGTAATTATTAAAGGGCGTGTGAACAAAATTACGGTTGCCACACGTTTCGTTGCCAGGCTCAGGGTCCCTGCAGTACTTGTATTTGGGTGTGGGATTGGTATCAGCACAAAGATCTCCAGTTTCCAGCGAAGGCTCAGTCTCTAAACACGCATCGTTGCAGGACTCGACCTCAGAGATACCCCTGAACACATGGTACAGTCCTAGACTGTGACCGATCTCGTGGATCATGGTATGAGTGTGGCCAAATGTACCATAGAAAGACGGATTCAGAACTAT

Function

symbol description
pappaa Predicted to enable metalloendopeptidase activity. Acts upstream of or within habituation and insulin-like growth factor receptor signaling pathway. Is expressed in Mauthner neurons; anterior lateral line ganglion; hindbrain interneuron; posterior lateral line ganglion; and statoacoustic (VIII) ganglion. Human ortholog(s) of this gene implicated in myocardial infarction. Orthologous to human PAPPA (pappalysin 1).

NR:

description
PREDICTED: protein LDOC1-like, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU59333 True 287 lncRNA 0.48 1 28254921 28255207

Neighbor

gene id symbol gene type direction distance location
LOC122344872 NA coding downstream 340332 27910227 ~ 27914589 (-)
LOC122346185 ugt2a4,ugt2a3,ugt2a1,LOC107548539,LOC107728043,LOC107556031,LOC107702978,LOC107728060,LOC107702979,LOC107693409,LOC107739983 coding downstream 639465 27605812 ~ 27615456 (-)
LOC122345116 ugt2a3,LOC107728060,LOC107702979,LOC107556030,LOC107728043,LOC107556031,LOC107702978,LOC107548539 coding downstream 650512 27593593 ~ 27604409 (-)
ythdc1 ythdc1,LOC107693408,LOC107702977,LOC107728241 coding downstream 665011 27575738 ~ 27589910 (-)
rilpl2 rilpl2,LOC107728107,LOC107702927 coding downstream 709671 27542420 ~ 27545250 (-)
LOC122346138 astn2,LOC107675510,LOC107683760,LOC106563268,LOC106565912 coding upstream 82194 28337401 ~ 28683169 (-)
LOC122344834 LOC108430399,LOC107568487,LOC105913012,LOC103355419 coding upstream 688534 28943741 ~ 28944764 (-)
brinp1 brinp1 coding upstream 919744 29174951 ~ 29270700 (-)
LOC122345544 ubr2,LOC107669566,LOC107696377 coding upstream 1047936 29303143 ~ 29323685 (-)
LOC122345545 LOC107728794,LOC107590009,LOC107696375,LOC107696371,LOC107578696,LOC108263699 coding upstream 1070776 29325983 ~ 29335688 (-)
G40076 pappaa,pappa,LOC107739977,LOC107675511,LOC107558864,LOC107728218,LOC107556005,LOC106563270 non-coding downstream 8256 28246418 ~ 28246665 (-)
G40074 pappaa,LOC107558864,LOC107675511,LOC107739977,LOC107728218,LOC107556005 non-coding downstream 11266 28242661 ~ 28243655 (-)
G40058 NA non-coding downstream 73922 28180624 ~ 28180999 (-)
G40057 NA non-coding downstream 74346 28180208 ~ 28180575 (-)
G40021 NA non-coding downstream 358960 27895643 ~ 27895961 (-)
G40081 NA non-coding upstream 37519 28292726 ~ 28292937 (-)
G40083 NA non-coding upstream 71690 28326897 ~ 28330476 (-)
G40264 NA non-coding upstream 1391410 29646617 ~ 29647013 (-)
G40266 NA non-coding upstream 1429921 29685128 ~ 29685727 (-)
G40268 LOC107741500,LOC107562332,LOC107704753 non-coding upstream 1545987 29801194 ~ 29805802 (-)
LOC122344874 NA other downstream 359467 27886041 ~ 27895454 (-)
isca1 isca1,LOC107702919,LOC107662049 other downstream 856180 27382921 ~ 27398741 (-)
LOC122345426 smpx,LOC107705278,LOC107671350,LOC107590224,LOC107663668,LOC107586736,LOC107721880 other downstream 1147536 27099815 ~ 27107385 (-)
LOC122344921 NA other downstream 2686235 25561974 ~ 25568686 (-)
G39413 LOC102215562 other downstream 2972635 25281886 ~ 25282286 (-)
G40080 pappaa,pappa,LOC107556005,LOC107558864,LOC107739977,LOC107675511,LOC107728218 other upstream 621 28255828 ~ 28264704 (-)
LOC122345120 LOC107728794,LOC107696375,LOC107590009,LOC107739482 other upstream 1068775 29323982 ~ 29326115 (-)
G40182 brinp1,LOC107715673,LOC107674904 other upstream 1205378 29460585 ~ 29490204 (-)
eng LOC107562335,LOC107704777,LOC107741503 other upstream 1359512 29614719 ~ 29655061 (-)
LOC122344966 LOC107749532,LOC107566852,LOC107742171,LOC107565644,LOC107690083 other upstream 1669495 29924702 ~ 29928675 (-)

Expression


Co-expression Network