G40670 (ythdc2)


Basic Information

Item Value
gene id G40670
gene name ythdc2
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056703.1
NCBI id CM032072.1
chromosome length 32833783
location 30564117 ~ 30564377 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU60181
CTGTCTGGACTGCTGCGCTCCCGCTGCTCCGCGGCGCTCCGGCCGGACGGGGTCTGTGGAGGCTCGTCTGCGGTCATGGGGCGAGGTCTCTGACCGATGCCGGTGGGCTGCTGGAGGCCGGCGCTCTGCTCCTCGGCCGTCAGAACCGACACCAGCGCGCGGATACTGGCCTCGTCCAGCTGAGAGCAGGACCTGGACGGAGAGCGGATCCGCCGCAGGAACAGACTCTGCCAGCGCTGCCTCAGACCAAACAGCAGCTCG

Function

symbol description
ythdc2 Enables 3'-5' RNA helicase activity; N6-methyladenosine-containing RNA binding activity; and RNA polymerase binding activity. Involved in positive regulation by host of viral genome replication; response to interleukin-1; and response to tumor necrosis factor. Colocalizes with endoplasmic reticulum.

NR:

description
PREDICTED: probable ATP-dependent RNA helicase YTHDC2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU60181 True 261 lncRNA 0.70 1 30564117 30564377

Neighbor

gene id symbol gene type direction distance location
LOC122344973 NA coding downstream 21677 30540497 ~ 30542440 (-)
LOC122345715 LOC107687242,LOC107717337,LOC107558070 coding downstream 26202 30535834 ~ 30537915 (-)
LOC122345124 si:zfos-128g4.1,LOC107675886,LOC107577831 coding downstream 40698 30520606 ~ 30523419 (-)
mbd2 mbd2,LOC107717343,LOC107565141,LOC108438699,LOC108260323,LOC105902559 coding downstream 52838 30491031 ~ 30511279 (-)
trabd2a trabd2a,LOC107558059,LOC107570885,LOC107717329 coding downstream 400100 30122226 ~ 30164017 (-)
LOC122344972 NA coding upstream 11911 30576288 ~ 30580328 (-)
ass1 ass1,LOC107740768,LOC107687233,LOC107689608 coding upstream 57827 30622204 ~ 30644747 (-)
surf4 surf4,LOC107740232,LOC107689610,LOC105890423,LOC103376134 coding upstream 81909 30646286 ~ 30652310 (-)
surf2 surf2,LOC107740795,LOC107581206,LOC107743090 coding upstream 88786 30653163 ~ 30655957 (-)
ciz1a ciz1a,LOC107687257,LOC107571633,LOC107740230,LOC107689607 coding upstream 95742 30660119 ~ 30672096 (-)
G40684 NA non-coding downstream 45662 30516065 ~ 30518455 (-)
G40680 NA non-coding downstream 51147 30504796 ~ 30512970 (-)
G40671 NA non-coding downstream 73239 30490514 ~ 30490878 (-)
G40677 NA non-coding downstream 79875 30484016 ~ 30484242 (-)
G40676 NA non-coding downstream 81891 30482021 ~ 30482226 (-)
G40672 NA non-coding upstream 1307 30565684 ~ 30566156 (-)
G40698 NA non-coding upstream 2874 30567251 ~ 30570100 (-)
G40701 NA non-coding upstream 25820 30590197 ~ 30590640 (-)
LOC122345983 NA non-coding upstream 144396 30708773 ~ 30710678 (-)
G40708 dnm1,LOC107568151,LOC107658356 non-coding upstream 155815 30720192 ~ 30725226 (-)
rnf170 rnf170,LOC107721034,LOC107687247 other downstream 470541 30087966 ~ 30093576 (-)
LOC122344966 LOC107749532,LOC107566852,LOC107742171,LOC107565644,LOC107690083 other downstream 635442 29924702 ~ 29928675 (-)
eng LOC107562335,LOC107704777,LOC107741503 other downstream 909056 29614719 ~ 29655061 (-)
G40182 brinp1,LOC107715673,LOC107674904 other downstream 1073913 29460585 ~ 29490204 (-)
LOC122345120 LOC107728794,LOC107696375,LOC107590009,LOC107739482 other downstream 1238002 29323982 ~ 29326115 (-)
fubp3 fubp3,LOC107689604,LOC107687236,LOC106566971 other upstream 26466 30590843 ~ 30613141 (-)
G40711 NA other upstream 66651 30631028 ~ 30733360 (-)
G40713 lzts3,LOC107567954,LOC107687254,LOC107574519,LOC795227,LOC107665914 other upstream 225256 30789633 ~ 30792719 (-)
G40752 hspa5,LOC107686379,LOC107743071,LOC107687227,LOC107567952,LOC107734417,LOC107734415,LOC107686377 other upstream 253355 30817732 ~ 30826358 (-)
LOC122344987 LOC107591496,LOC107663763,LOC107725109,LOC107734348,LOC107563429,LOC107654309 other upstream 766972 31331349 ~ 31350449 (-)

Expression


Co-expression Network