LOC122346060 (cacna1ba,LOC107560222,LOC107587427,LOC107709695)


Basic Information

Item Value
gene id LOC122346060
gene name cacna1ba,LOC107560222,LOC107587427,LOC107709695
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056703.1
NCBI id CM032072.1
chromosome length 32833783
location 2433286 ~ 2435700 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XR_006251082.1
CGTCTCCTTCATTTTCCTTTGTTCTTTCTTGATGTTGAACCTGTTTGTGGCTGTCATTATGGACAACTTTGAATATCTGACACGTGACTCCTCCATCTTGGGCCCTCACCACCTGGATGAGTTTATCCGAGTGTGGGCGGAGTATGACCCAGCCGCATGTGGCCGTGTCAAGTACCTCGATATGTATGAGATGCTGCTCCACATGTCCCCACCTTTAGGTTTGGGAAAGAAATGCCCTCCACGAATCGCCTACAAG

Function

symbol description
cacna1ba Predicted to enable voltage-gated calcium channel activity. Predicted to be involved in calcium ion import and chemical synaptic transmission. Predicted to act upstream of or within calcium ion transmembrane transport and regulation of ion transmembrane transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be part of voltage-gated calcium channel complex. Is expressed in atrium; brain; cardiac ventricle; and liver. Human ortholog(s) of this gene implicated in Lambert-Eaton myasthenic syndrome and dystonia 23. Orthologous to human CACNA1B (calcium voltage-gated channel subunit alpha1 B).

NR:

description
PREDICTED: voltage-dependent N-type calcium channel subunit alpha-1B-like, partial

GO:

id name namespace
GO:0034765 regulation of ion transmembrane transport biological_process
GO:0070588 calcium ion transmembrane transport biological_process
GO:0005891 voltage-gated calcium channel complex cellular_component
GO:0005245 voltage-gated calcium channel activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XR_006251082.1 True 256 lncRNA 0.49 3 2433286 2435700

Neighbor

gene id symbol gene type direction distance location
LOC122346100 LOC107757959,LOC107587426,LOC107709681,LOC107681216,LOC107560221,LOC107560220 coding downstream 15233 2385151 ~ 2418053 (-)
LOC122345768 LOC107562125,LOC107690349,LOC107554462,LOC107715242 coding downstream 334105 2090152 ~ 2099181 (-)
LOC122346063 LOC107747844,LOC107554104,LOC107556635,LOC107667225 coding downstream 343130 2087785 ~ 2090156 (-)
LOC122344882 gnrhr4,LOC107715601,LOC107575089,LOC107690392,LOC107715190,LOC107691141 coding downstream 374553 2052705 ~ 2058733 (-)
LOC122344761 ngly1,LOC107748685,LOC107696895,LOC107739561,LOC107688325,LOC107579448 coding downstream 534696 1893780 ~ 1898590 (-)
purba LOC107737074,LOC107755849,LOC107668742,LOC107670383,LOC107599601,LOC108431741,LOC107580671 coding upstream 88859 2524559 ~ 2527337 (-)
zgc:65851 zgc:65851,LOC107670379,LOC107708255,LOC107668750,LOC107599600,LOC107755851,LOC107573085 coding upstream 100325 2536025 ~ 2543574 (-)
mxd1 mxd1,LOC107670395,LOC107708253 coding upstream 119776 2555476 ~ 2579803 (-)
LOC122345702 figla coding upstream 171514 2607214 ~ 2609585 (-)
tet3 LOC107654213,LOC107708251,LOC107557386,LOC107697244,LOC107551814,LOC107755856 coding upstream 388471 2824171 ~ 2866043 (-)
G32740 cacna1ba,LOC107709695,LOC107757972,LOC107587427,LOC107681248,LOC107560222,LOC107690670 non-coding downstream 8474 2422985 ~ 2424812 (-)
LOC122344845 LOC107709689,LOC107560224,LOC107681222 non-coding downstream 48585 2383907 ~ 2384701 (-)
LOC122344860 LOC107560224,LOC107690695,LOC107757958,LOC107681222,LOC107709689,LOC107587469 non-coding downstream 53891 2377967 ~ 2379395 (-)
G32727 LOC107681241 non-coding downstream 57623 2374002 ~ 2375663 (-)
LOC122346102 NA non-coding downstream 76506 2355966 ~ 2356780 (-)
G32870 NA non-coding upstream 216744 2652444 ~ 2728807 (-)
G32881 NA non-coding upstream 314259 2749959 ~ 2797599 (-)
G32882 NA non-coding upstream 329583 2765283 ~ 2766771 (-)
G32883 NA non-coding upstream 332079 2767779 ~ 2774190 (-)
G32884 NA non-coding upstream 333501 2769201 ~ 2770371 (-)
LOC122344636 pex11a,LOC107556261,LOC107714788,LOC107690406,LOC107691149,LOC107715221,LOC107551461 other downstream 410364 2020096 ~ 2022922 (-)
G32676 NA other downstream 465538 1966637 ~ 1967748 (-)
ypel1 ypel1,YPEL1,ypelc,ypel2b,LOC103374080,LOC106586007 other downstream 739000 1673024 ~ 1694286 (-)
lrrc74b lrrc74b,LOC107755819,LOC107667596,LOC107599620 other downstream 1078872 1342606 ~ 1354414 (-)
castor1 gatsl3,LOC107755828,LOC107726730,LOC107704487 other downstream 1097099 1312604 ~ 1336187 (-)
G32857 NA other upstream 60804 2496504 ~ 2554146 (-)
snrnp27 snrnp27 other upstream 144848 2580548 ~ 2585452 (-)
add2 add2,LOC107668755 other upstream 150887 2586587 ~ 2605917 (-)
LOC122344624 LOC107699921,LOC107708239,LOC107755860,LOC107697241,LOC107551809 other upstream 500043 2935743 ~ 3012819 (-)
G32908 sema4c,LOC107697240,LOC107708238,LOC107699920 other upstream 515762 2951462 ~ 2960177 (-)

Expression


Co-expression Network