G43514 (spega,LOC107731772,LOC107688815,LOC107586363,LOC107719300)


Basic Information

Item Value
gene id G43514
gene name spega,LOC107731772,LOC107688815,LOC107586363,LOC107719300
gene type unknown
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056704.1
NCBI id CM032073.1
chromosome length 27473687
location 8047102 ~ 8048008 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU64510
TCAATGAGACTATACAAGATGTCTTTGCCTGTGCAATACTCTGTTATGAGTACAAGGTAGCGAGGTGTGATATAGGCTTCATGTAGGGCCATGATTTTTTCACAACGGAGGGACTTGAGGATCTCATACTCCTTTATGACCCCTTGCTTGGTCTGCTGATCATAGGGAATAATCTTTGCTATAAACATCTTGCCAGTTGAGTTTTCTCTGCAATCCTTTATTACTCCAAAACGACCCCTGGCTTTCTCATCTAAAAAGCTGTATGGTTTCTGAGGAACTCCTTGCCTCAAAGTGGTCTCAGTTTTGGTGGAGGATACCACTCTTTCAATAGTTGTCTCTGGTGTGGGTGAGCTTGCTCCTTCTCCTACTGGACTGATGCTGCTGACCAAGATCACAGGAGGAGAGATAGGCGTGGGAGCAACTGAAGAAGTGGCTGGAACATATGAAGGAATAGGGGATATTGATCTGCATATTGAGGGTGGAGCTGTGTTTGACCTTGCAGATAAAGTCTGGGTTTGGGTAACAGGGGAAACTATGTTGATAGTGCTTTTGGCTTGGGGTGAAGAAGAGGAGGGATTGACATCTTTGGGCAAATGTGAGAAACTGGCAGCTCAGAAGATGTATTTGTGACAGCATCAGACTGTGCAGGAATAGGACTAACGTCCTGACTAACACTTGGTTCTGCTAATGTAGAAGTAGAAGTAGACACAGGAACAACAGAAAAAGGAGAGGGGTGTGTCTTCTTTTCAGCAGGCTGATGG

Function

symbol description
spega Predicted to enable protein kinase activity. Predicted to act upstream of or within muscle organ development. Predicted to be located in nucleus. Is expressed in brain. Human ortholog(s) of this gene implicated in centronuclear myopathy 5. Orthologous to human SPEG (striated muscle enriched protein kinase).

NR:

description
PREDICTED: striated muscle preferentially expressed protein kinase-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU64510 True 761 TUCP 0.45 2 8047102 8048008

Neighbor

gene id symbol gene type direction distance location
inha inha,LOC107731770,LOC107688903,LOC107719299,LOC107694906,LOC107569459,LOC107586362 coding downstream 31343 8013125 ~ 8015759 (-)
LOC122347101 igfbp2,igfbp2a,LOC107731775,LOC107688817,LOC107719297,LOC107663074,LOC108438161 coding downstream 67013 7965748 ~ 7980089 (-)
LOC122346795 igfbp2,igfbp2a,LOC107688817,LOC107731775,LOC107719297,LOC107663074,LOC108438161 coding downstream 314778 7725403 ~ 7732324 (-)
LOC122347094 tns1a,LOC107688818,LOC107709585,LOC107719294,LOC107562221,LOC107663075 coding downstream 351983 7661464 ~ 7695119 (-)
tns1a tns1a,LOC107688818,LOC107709585,LOC107663075,LOC107719294,LOC107586330 coding downstream 387902 7608473 ~ 7659200 (-)
cacng1a cacng1a,cacng1,LOC107586374,LOC107688902,LOC107716892,LOC107569457 coding upstream 135007 8183015 ~ 8188384 (-)
cacng4a LOC107688901,LOC107586376,LOC107716888 coding upstream 151103 8199111 ~ 8202841 (-)
psmd12 psmd12,LOC107688808,LOC107694910 coding upstream 154971 8202979 ~ 8206792 (-)
c6h22orf23 LOC107716895,LOC107586342,LOC107688809 coding upstream 179416 8227424 ~ 8232954 (-)
ppp1r12c ppp1r12c,LOC107688807,LOC107586341,LOC107710164,LOC107569470 coding upstream 185727 8233735 ~ 8246233 (-)
G43528 NA non-coding downstream 189506 7856465 ~ 7857596 (-)
G43516 NA non-coding downstream 247405 7798124 ~ 7799697 (-)
G43478 NA non-coding downstream 548667 7461191 ~ 7498435 (-)
G43472 NA non-coding downstream 616656 7429778 ~ 7430446 (-)
G43251 NA non-coding downstream 1224081 6815260 ~ 6823021 (-)
G43513 LOC107688815 non-coding upstream 1389 8049397 ~ 8050678 (-)
G43660 NA non-coding upstream 134671 8182679 ~ 8182882 (-)
G43691 NA non-coding upstream 246046 8294054 ~ 8294286 (-)
G43697 NA non-coding upstream 266415 8314423 ~ 8314623 (-)
G43700 NA non-coding upstream 286354 8334362 ~ 8343514 (-)
LOC122346476 cidec,LOC107731779,LOC107688813,LOC107694911,LOC107710160 other downstream 276651 7737090 ~ 7770451 (-)
G43463 nomo,LOC107677623,LOC107562229,LOC107709581,LOC107733372,LOC107688882 other downstream 460735 7579895 ~ 7586367 (-)
nomo nomo,LOC107677623,LOC107562229,LOC107709581,LOC107733372,LOC107688882,LOC107586361 other downstream 717537 7316947 ~ 7329565 (-)
LOC122346787 unc80,LOC107733373,LOC107677624,LOC107688825 other downstream 732328 7274840 ~ 7314774 (-)
agap1 agap1,LOC107688827,LOC107709574,LOC107677621,LOC107748916,LOC107586321,LOC103044997 other downstream 801923 7108162 ~ 7245179 (-)
G43801 pick1,LOC107734822,LOC107734770,LOC107572282 other upstream 660698 8708706 ~ 8713858 (-)
G43890 NA other upstream 1212608 9260616 ~ 9261245 (-)
G43896 NA other upstream 1217994 9266002 ~ 9267324 (-)
G43899 NA other upstream 1221180 9269188 ~ 9270922 (-)
G43900 NA other upstream 1223410 9271418 ~ 9272305 (-)

Expression


Co-expression Network