G44031 (rptor,LOC107553319)


Basic Information

Item Value
gene id G44031
gene name rptor,LOC107553319
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056704.1
NCBI id CM032073.1
chromosome length 27473687
location 9892231 ~ 9898950 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU65205
CCTGCACTTTCATTTCCCTTTCTGTGTCCCAGATCCGTATGACTCTAACATCCCCTGACGTCATCAAGAGGCCAGTCTCCTGCTCCCAGTCCACCACCATACCTGCACCTTCCTGCTTACTTCTGTCAAGATAGATTGAGACCCGCTGGCCCAAACCTCGTGTAGTGGGCAGCATGTCCGACAGCCCCTGCCACGCTGTGACCATCTCGGGATTTCTCTGGTCAGCAAAGTTCTTCCAAATTCGCAAAG

Function

symbol description
rptor Predicted to enable protein-macromolecule adaptor activity. Predicted to be involved in several processes, including TORC1 signaling; cellular response to amino acid stimulus; and positive regulation of protein serine/threonine kinase activity. Predicted to be part of TORC1 complex. Predicted to be active in cytoplasm. Is expressed in head; notochord; post-vent region; pronephros; and spinal cord. Orthologous to human RPTOR (regulatory associated protein of MTOR complex 1).

NR:

description
PREDICTED: regulatory-associated protein of mTOR isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU65205 True 249 lncRNA 0.53 3 9892231 9898950

Neighbor

gene id symbol gene type direction distance location
LOC122346913 nptx1,LOC107750979,LOC107553322,LOC107667295,LOC107701212 coding downstream 110248 9778250 ~ 9781983 (-)
LOC122346819 rptor,LOC107553319 coding downstream 181633 9586425 ~ 9710598 (-)
si:dkey-237i9.1 LOC107567927,LOC107667603,LOC107591922,LOC107667296,LOC107731096,LOC108272757,LOC108424802 coding downstream 539563 9308586 ~ 9352668 (-)
nol11 nol11,LOC107567930,LOC107734779,LOC107728513,LOC107660301 coding downstream 593188 9283403 ~ 9299043 (-)
srp68 srp68 coding downstream 896598 8971674 ~ 8995633 (-)
trim25 trim25,LOC107710025,LOC107553309,LOC107669536 coding upstream 140477 10039427 ~ 10048868 (-)
utp6 utp6,LOC107710019 coding upstream 202533 10101483 ~ 10106808 (-)
tefm tefm,LOC107591914 coding upstream 224865 10123815 ~ 10126741 (-)
znf207b znf207b,LOC107669543,LOC107710013,LOC107553300 coding upstream 247274 10146224 ~ 10152064 (-)
rhbdl3 rhbdl3,LOC107718708,LOC107701837,LOC107698683,LOC107591910,LOC107754871 coding upstream 268286 10167236 ~ 10202756 (-)
G43991 NA non-coding downstream 162571 9385109 ~ 9729660 (-)
G43916 NA non-coding downstream 609763 9281515 ~ 9282468 (-)
G43915 NA non-coding downstream 610829 9280931 ~ 9281402 (-)
G43906 NA non-coding downstream 616159 9275640 ~ 9276072 (-)
G43894 NA non-coding downstream 627657 9264327 ~ 9264574 (-)
G44014 NA non-coding upstream 24275 9923225 ~ 9926256 (-)
G44015 NA non-coding upstream 28281 9927231 ~ 9928405 (-)
G44036 p4hb,LOC107728011,LOC107591928,LOC107553316,LOC107701207 non-coding upstream 31836 9930786 ~ 9940614 (-)
G44038 NA non-coding upstream 34751 9933701 ~ 9935477 (-)
G44037 ppp1r27,LOC107710012,LOC107591937,LOC107553297 non-coding upstream 42620 9941570 ~ 9942006 (-)
G43900 NA other downstream 619926 9271418 ~ 9272305 (-)
G43899 NA other downstream 621309 9269188 ~ 9270922 (-)
G43896 NA other downstream 624907 9266002 ~ 9267324 (-)
G43890 NA other downstream 630986 9260616 ~ 9261245 (-)
G43801 pick1,LOC107734822,LOC107734770,LOC107572282 other downstream 1178373 8708706 ~ 8713858 (-)
anapc11 anapc11,LOC107553313 other upstream 46717 9945667 ~ 9948988 (-)
c6h17orf67 cunh17orf67,LOC107591943,LOC107669532,LOC107701203,LOC103044666 other upstream 126503 10025453 ~ 10027680 (-)
cd7al LOC107710016,LOC107553302,LOC107669545,LOC107698686,LOC107710292,LOC107591915,LOC107553301,LOC107710015 other upstream 239955 10138905 ~ 10145168 (-)
tnrc6c2 LOC107701838,LOC107566423,LOC107754870,LOC107591908,LOC107718711,LOC107698681 other upstream 305667 10204617 ~ 10243425 (-)
LOC122347367 NA other upstream 456927 10355877 ~ 10358850 (-)

Expression


Co-expression Network