G44252 (ntn1a)



Basic Information


Item Value
gene id G44252
gene name ntn1a
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information


Item Value
chromosome id NC_056704.1
NCBI id CM032073.1
chromosome length 27473687
location 10599748 ~ 10600064 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence


>TU65536
GCCTGCTAATCGTTTAGACGTAGCGTTTTCCGCTTTCCTATGGAAGCGTCAAGTAATAAGTTGCAGACTTTGGGCCCTTAAGACCGAACCTCGTCGCTCTTTTCGCCTGTGGTGTTTAGATTCAGTACCCTTCATACCTTTGCAGGCCTTTCTGTGAGAGATGGGCTTGGACATGTCTCTGTAGTAGCCCTCTTTGCAGTAGTGGCAGTGGCGGCCCGCCGTATTGTGACGGCAGTTCAGGCAGACTCCTCCGCTTTTCCTCCCGGAGAGTTTATAAAGCTCCATGTTGAAACGACAGCGCCTCGCATGGAGGTTAC

Function


symbol description
ntn1a Acts upstream of or within several processes, including circulatory system development; closure of optic fissure; and neuron differentiation. Predicted to be located in extracellular region. Predicted to be active in basement membrane. Is expressed in several structures, including brain; head; optic cup; optic vesicle; and somite. Human ortholog(s) of this gene implicated in congenital mirror movement disorder. Orthologous to human NTN1 (netrin 1).

NR:

description
Ntn1a protein

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU65536 True 317 lncRNA 0.52 1 10599748 10600064

Neighbor


gene id symbol gene type direction distance location
stx8 stx8,LOC107704006,LOC107555374,LOC107733906,LOC107569362,LOC107660464,LOC107757428 coding upstream 20943 10523980 ~ 10578805 (+)
mchr1a mchr1a,LOC107704000,LOC107728182,LOC107733891,LOC107561025,LOC107659856 coding upstream 169210 10427591 ~ 10430538 (+)
rhot1b rhot1b,LOC107669542,LOC107710015,LOC107553301,LOC105892309,LOC103373013 coding upstream 458141 10130646 ~ 10141607 (+)
LOC122346392 NA coding upstream 469205 10126776 ~ 10130543 (+)
suz12b suz12,LOC107710018,LOC107553303,LOC107669539,LOC107591916 coding upstream 483467 10107180 ~ 10116281 (+)
LOC122347357 LOC107733903,LOC107704004,LOC107555376,LOC107569359 coding downstream 238384 10838448 ~ 10858010 (+)
glulb glulb,LOC107555380,LOC107733907,LOC107704001,LOC107757425,LOC107660462,LOC107569358,LOC102795441,LOC105019150 coding downstream 300942 10901006 ~ 10904025 (+)
znf648 LOC107678353,LOC107555382,LOC107733900,LOC107719322,LOC107660466,LOC107564440 coding downstream 322604 10922668 ~ 10930433 (+)
gadd45ab gadd45ab,gadd45a,LOC107555372,LOC107678351,LOC107670797,LOC108272203 coding downstream 343688 10943752 ~ 10946264 (+)
tgfbr3 tgfbr3,LOC107749982,LOC107555391,LOC107564431,LOC107675425,LOC107678350,LOC107730687 coding downstream 473111 11073175 ~ 11162716 (+)
G44248 NA non-coding upstream 16067 10582349 ~ 10583681 (+)
G44245 NA non-coding upstream 45153 10521974 ~ 10554595 (+)
G44246 LOC107733892,LOC107555367,LOC107703995 non-coding upstream 76526 10516890 ~ 10523222 (+)
G44225 NA non-coding upstream 155672 10434521 ~ 10444076 (+)
G44220 NA non-coding upstream 172161 10426411 ~ 10427587 (+)
LOC122346901 NA non-coding downstream 62056 10662120 ~ 10663689 (+)
G44297 NA non-coding downstream 391306 10991370 ~ 10991602 (+)
G44298 NA non-coding downstream 396344 10996408 ~ 10997516 (+)
G44301 LOC107577034,LOC107675434,LOC107564434,LOC107730699,LOC107678357,LOC107733908 non-coding downstream 400627 11000691 ~ 11001355 (+)
G44440 NA non-coding downstream 615983 11216047 ~ 11216274 (+)
atad5b LOC107578257,LOC107710017,LOC107669538 other upstream 476223 10116617 ~ 10123525 (+)
dgke dgke,LOC107669536,LOC107710025,LOC107710026,LOC107669537,LOC107553311,LOC107591925,LOC107701198 other upstream 559384 9979865 ~ 10040364 (+)
LOC122346828 mcrip1,LOC107710264,LOC107553315,LOC107710031,LOC107591941,LOC108424716 other upstream 651819 9944518 ~ 9947929 (+)
pecam1b NA other upstream 673491 9916050 ~ 9926257 (+)
G43962 rptor,LOC107728013,LOC107700860,LOC107553319 other upstream 788173 9786840 ~ 9811575 (+)
LOC122347096 LOC107704003,LOC107733914,LOC107555377,LOC107569363,LOC107660471,LOC107757423 other downstream 270314 10870378 ~ 10882899 (+)
pik3r6a zgc:158654,LOC107733898,LOC107555378,LOC107704002,LOC107757422,LOC105903457 other downstream 282896 10882960 ~ 10892460 (+)
G44478 LOC107749977,LOC107730703,LOC107675437,LOC107564626,LOC107698886,LOC107555394 other downstream 815209 11415273 ~ 11420330 (+)
LOC122346564 LOC107733248,LOC107694106,LOC107576895 other downstream 1402083 12002147 ~ 12010539 (+)
G44588 NA other downstream 1487335 12087399 ~ 12092455 (+)

Expression



Co-expression Network