G44521


Basic Information

Item Value
gene id G44521
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056704.1
NCBI id CM032073.1
chromosome length 27473687
location 11641081 ~ 11643698 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU65889
ctgtcacggttgtgtggtaagcacgagagcacacaacgagattcaatgaaaataaaggggtttaattccagaatggtaaaataaaagatatacagacaggcaggcaggtcggtcgaacaggcaggcaggataaacacaggtagggacattgggtagggaccttgacgctcggaccaacagaactcaaaacacaggacttaaatacacagggtaattgacgagacacagctgatgacaataacataattaacacagagggaaggcagggcacagg
>TU65890
ctgtcacggttgtgtggtaagcacgagagcacacaacgagattcaatgaaaataaaggggtttaattccagaatggtaaaataaaagatatacagacaggcaggcaggataaacacaggtagggacattgggtagggaccttgacgctcggaccaacagaactcaaaacacaggacttaaatacacagggtaattgacgagacacagctgatgacaataacataattaacacagagggaaggcagggcacagg

Function

NR:

description
DNA-directed RNA polymerases I, II, and III subunit RPABC3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU65889 True 274 lncRNA 0.46 2 11641081 11643698
TU65890 False 253 lncRNA 0.44 2 11641081 11643698

Neighbor

gene id symbol gene type direction distance location
LOC122346915 kyat3,ccbl2,si:ch73-97h19.2,LOC107698888,LOC100332215 coding upstream 193154 11442111 ~ 11447927 (+)
barhl2 barhl2,LOC107675428,LOC107678352,LOC107555373,LOC107564632 coding upstream 382514 11254609 ~ 11258567 (+)
znf644b znf644b,LOC107749981,LOC107555369,LOC107675435,LOC107730700,LOC107564430 coding upstream 440157 11179828 ~ 11200924 (+)
tgfbr3 tgfbr3,LOC107749982,LOC107555391,LOC107564431,LOC107675425,LOC107678350,LOC107730687 coding upstream 478365 11073175 ~ 11162716 (+)
gadd45ab gadd45ab,gadd45a,LOC107555372,LOC107678351,LOC107670797,LOC108272203 coding upstream 694817 10943752 ~ 10946264 (+)
dzip1l LOC107679858,LOC107756183,LOC107593178,LOC107751311,LOC107577891 coding downstream 147972 11791670 ~ 11801796 (+)
trnai-aau_2 NA coding downstream 329273 11972971 ~ 11973044 (+)
farp2 farp2,LOC107694112,LOC107696757 coding downstream 367397 12011095 ~ 12055010 (+)
boka boka,bok,LOC107733256,LOC107752647,LOC107696759,LOC107694130 coding downstream 421600 12065298 ~ 12074564 (+)
atg4b atg4b,LOC107696761,LOC107552278,LOC107593167,LOC107694120 coding downstream 431752 12075450 ~ 12082028 (+)
G44483 NA non-coding upstream 212251 11427845 ~ 11428830 (+)
G44467 NA non-coding upstream 393073 11247791 ~ 11248008 (+)
G44465 NA non-coding upstream 395087 11245685 ~ 11245994 (+)
G44456 NA non-coding upstream 399056 11241794 ~ 11242025 (+)
G44455 NA non-coding upstream 399394 11241120 ~ 11241687 (+)
LOC122347449 NA non-coding downstream 45994 11689692 ~ 11705926 (+)
G44568 sox14,LOC107679857,LOC107756185,LOC107713406,LOC107713405,LOC107694108,LOC103365676 non-coding downstream 135332 11779030 ~ 12264787 (+)
G44574 hdlbpa,hdlbp,LOC107752661,LOC107694132,LOC107733253,LOC107696756 non-coding downstream 293403 11937101 ~ 11977411 (+)
G44575 hdlbp,LOC107733253,LOC107694132,LOC107552253,LOC107696756,LOC107752661 non-coding downstream 349860 11993558 ~ 11994137 (+)
G44604 NA non-coding downstream 833426 12477124 ~ 12482182 (+)
G44478 LOC107749977,LOC107730703,LOC107675437,LOC107564626,LOC107698886,LOC107555394 other upstream 220751 11415273 ~ 11420330 (+)
pik3r6a zgc:158654,LOC107733898,LOC107555378,LOC107704002,LOC107757422,LOC105903457 other upstream 748621 10882960 ~ 10892460 (+)
LOC122347096 LOC107704003,LOC107733914,LOC107555377,LOC107569363,LOC107660471,LOC107757423 other upstream 758182 10870378 ~ 10882899 (+)
atad5b LOC107578257,LOC107710017,LOC107669538 other upstream 1517556 10116617 ~ 10123525 (+)
dgke dgke,LOC107669536,LOC107710025,LOC107710026,LOC107669537,LOC107553311,LOC107591925,LOC107701198 other upstream 1600717 9979865 ~ 10040364 (+)
LOC122346564 LOC107733248,LOC107694106,LOC107576895 other downstream 358449 12002147 ~ 12010539 (+)
G44588 NA other downstream 443701 12087399 ~ 12092455 (+)
scly scly,LOC107552249,LOC107552250,LOC107752645 other downstream 510570 12154268 ~ 12159899 (+)
LOC122347491 LOC107593172,LOC107593170,LOC107694117,LOC107753639,LOC107552274 other downstream 878075 12521773 ~ 12526957 (+)
crocc2 crocc2,LOC107593190,LOC107753661,LOC107694109,LOC107752664,LOC107552261,LOC107696746 other downstream 1122123 12765821 ~ 12805700 (+)

Expression


Co-expression Network