G44575 (hdlbp,LOC107733253,LOC107694132,LOC107552253,LOC107696756,LOC107752661)



Basic Information


Item Value
gene id G44575
gene name hdlbp,LOC107733253,LOC107694132,LOC107552253,LOC107696756,LOC107752661
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information


Item Value
chromosome id NC_056704.1
NCBI id CM032073.1
chromosome length 27473687
location 11993558 ~ 11994137 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence


>TU65972
CCTTCTCCTCATAAATCTTCTTGATCTTGGCCATGGCCAGGGCAACCTGCTCTTTCTCCCCAGTGATGACGATCTCCGTTTTGTTCACACTTGGTGGGGGGACATTAATGCGGGCTCCTGTCTCCTGCATCAATTCCCCCACCAGCTTGTTATAAGCTCCAGTGATGAAGGGATGATACACCTTTTCAATGTTCATTCTCTCCACAGCACGCTTATCCTTCTCATGTCTGGCCTTTTCCAAGCCTTCCTTGGTTCCAGAGATCTTGATGAGGTTACTGGGGTCTTCGGGTCTAGGGATCTGGATCTTGGTGGCAGTCTTCAGTTCAAGCTCCTGTAGCTTCTCCCCACTTTTGCCAATGACAAAGCGATGATGTTCTTTGGGGATGGCCACAGTAGCTGAAGCCTGTAGTCAAGTCAATGCAGCGGTTACAAA

Function


symbol description
hdlbp Enables RNA binding activity and cadherin binding activity. Predicted to be involved in cholesterol metabolic process and lipid transport. Located in cytosol.

NR:

description
PREDICTED: vigilin-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU65972 True 433 lncRNA 0.49 2 11993558 11994137

Neighbor


gene id symbol gene type direction distance location
trnai-aau_2 NA coding upstream 20514 11972971 ~ 11973044 (+)
dzip1l LOC107679858,LOC107756183,LOC107593178,LOC107751311,LOC107577891 coding upstream 191762 11791670 ~ 11801796 (+)
LOC122346915 kyat3,ccbl2,si:ch73-97h19.2,LOC107698888,LOC100332215 coding upstream 545631 11442111 ~ 11447927 (+)
barhl2 barhl2,LOC107675428,LOC107678352,LOC107555373,LOC107564632 coding upstream 734991 11254609 ~ 11258567 (+)
znf644b znf644b,LOC107749981,LOC107555369,LOC107675435,LOC107730700,LOC107564430 coding upstream 792634 11179828 ~ 11200924 (+)
farp2 farp2,LOC107694112,LOC107696757 coding downstream 16958 12011095 ~ 12055010 (+)
boka boka,bok,LOC107733256,LOC107752647,LOC107696759,LOC107694130 coding downstream 71161 12065298 ~ 12074564 (+)
atg4b atg4b,LOC107696761,LOC107552278,LOC107593167,LOC107694120 coding downstream 81313 12075450 ~ 12082028 (+)
kif1aa kif1aa,kif1a,LOC107696745,LOC107694128,LOC107552277,LOC108427666,LOC107593169 coding downstream 103543 12097680 ~ 12152964 (+)
LOC122346457 scly,LOC107552249,LOC107552250,LOC107752645 coding downstream 444963 12439100 ~ 12444241 (+)
G44574 hdlbpa,hdlbp,LOC107752661,LOC107694132,LOC107733253,LOC107696756 non-coding upstream 16147 11937101 ~ 11977411 (+)
LOC122347449 NA non-coding upstream 287632 11689692 ~ 11705926 (+)
G44521 NA non-coding upstream 349860 11641081 ~ 11643698 (+)
G44483 NA non-coding upstream 564728 11427845 ~ 11428830 (+)
G44467 NA non-coding upstream 745550 11247791 ~ 11248008 (+)
G44604 NA non-coding downstream 482987 12477124 ~ 12482182 (+)
G44606 LOC107593190,LOC107696746,LOC107552261,LOC107753661,LOC107694109,LOC107752664 non-coding downstream 498816 12492953 ~ 12493642 (+)
G44611 NA non-coding downstream 569955 12564092 ~ 12671665 (+)
G44622 NA non-coding downstream 670683 12664820 ~ 12699577 (+)
G44615 NA non-coding downstream 1089243 13083380 ~ 13084230 (+)
G44478 LOC107749977,LOC107730703,LOC107675437,LOC107564626,LOC107698886,LOC107555394 other upstream 573228 11415273 ~ 11420330 (+)
pik3r6a zgc:158654,LOC107733898,LOC107555378,LOC107704002,LOC107757422,LOC105903457 other upstream 1101098 10882960 ~ 10892460 (+)
LOC122347096 LOC107704003,LOC107733914,LOC107555377,LOC107569363,LOC107660471,LOC107757423 other upstream 1110659 10870378 ~ 10882899 (+)
atad5b LOC107578257,LOC107710017,LOC107669538 other upstream 1870033 10116617 ~ 10123525 (+)
dgke dgke,LOC107669536,LOC107710025,LOC107710026,LOC107669537,LOC107553311,LOC107591925,LOC107701198 other upstream 1953194 9979865 ~ 10040364 (+)
LOC122346564 LOC107733248,LOC107694106,LOC107576895 other downstream 8010 12002147 ~ 12010539 (+)
G44588 NA other downstream 93262 12087399 ~ 12092455 (+)
scly scly,LOC107552249,LOC107552250,LOC107752645 other downstream 160131 12154268 ~ 12159899 (+)
LOC122347491 LOC107593172,LOC107593170,LOC107694117,LOC107753639,LOC107552274 other downstream 527636 12521773 ~ 12526957 (+)
crocc2 crocc2,LOC107593190,LOC107753661,LOC107694109,LOC107752664,LOC107552261,LOC107696746 other downstream 771684 12765821 ~ 12805700 (+)

Expression



Co-expression Network