G25524


Basic Information

Item Value
gene id G25524
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 1330371 ~ 1330753 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU28796
AATCATTCCTTACTTTATTATTGTTACACCAACAATTTACCGTCCATCTCGCACATTAAAAAATGTGTTCTTTTACCAACTAGCAAACTCCAATCAGCGCTGACTACCAAGAGTGTGGTGTAGTCAATTTAAAACTGATCTTCAATCAGTAACCAGTCAGTTGTTGTTCAGTCCAGCCCCTGTATTTTTTTTCAGCACTTGATGAATTGATGAGTGACCTCATAGATCCCCACAGACTCACTGGCTTTCTCGTCATAGTTGATTTCAGGGAACTGGGTGGTGGTCTCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU28796 True 288 lncRNA 0.41 2 1330371 1330753

Neighbor

gene id symbol gene type direction distance location
CI01000004_01311508_01319203 ALDH9A1B, ALDH9A1 coding downstream 11168 1311055 ~ 1319203 (-)
CI01000004_01280983_01292761 FZR1B coding downstream 37610 1280585 ~ 1292761 (-)
CI01000004_01252844_01260204 NA coding downstream 70017 1252652 ~ 1260354 (-)
CI01000004_01230991_01235864 NA coding downstream 94507 1230896 ~ 1235864 (-)
CI01000004_01199771_01204393 OTOL1A coding downstream 124122 1199491 ~ 1206249 (-)
CI01000004_01352499_01377500 SLC1A7A, SLC1A7 coding upstream 21320 1352073 ~ 1377515 (-)
CI01000004_01394018_01397517 TMEM125B coding upstream 63216 1393969 ~ 1397517 (-)
CI01000004_01404265_01425424 NA coding upstream 73512 1404265 ~ 1425424 (-)
CI01000004_01440447_01443088 NA coding upstream 109018 1439771 ~ 1443292 (-)
CI01000004_01554696_01564701 NA coding upstream 223903 1554656 ~ 1564701 (-)
G25525 NA non-coding downstream 6081 1321082 ~ 1324290 (-)
G25451 NA non-coding downstream 197794 1132270 ~ 1132577 (-)
G25439 NA non-coding downstream 209410 1120349 ~ 1120961 (-)
G25057 NA non-coding downstream 214879 1112772 ~ 1115492 (-)
G25527 NA non-coding upstream 1810 1332563 ~ 1333989 (-)
G25515 NA non-coding upstream 95939 1426692 ~ 1427877 (-)
G25511 NA non-coding upstream 101094 1431847 ~ 1435337 (-)
G25572 NA non-coding upstream 118382 1449135 ~ 1449927 (-)
G25561 NA non-coding upstream 216998 1547751 ~ 1552872 (-)
CI01000004_01773383_01774888 INSL5B other upstream 442287 1772928 ~ 1774942 (-)
G26788 NA other upstream 1943680 3267683 ~ 3275721 (-)
G27746 NA other upstream 3847474 5178227 ~ 5203724 (-)
CI01000004_05617072_05627369 NA other upstream 4289630 5616644 ~ 5628289 (-)
CI01000004_06539836_06541252 NA other upstream 5204074 6538904 ~ 6541252 (-)

Expression


Co-expression Network