G46735 (sirt4,LOC107712059,LOC107584486,LOC107568197,LOC107721201)



Basic Information


Item Value
gene id G46735
gene name sirt4,LOC107712059,LOC107584486,LOC107568197,LOC107721201
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information


Item Value
chromosome id NC_056704.1
NCBI id CM032073.1
chromosome length 27473687
location 20008095 ~ 20008583 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence


>TU69226
CATGAAGTTCAGTTAGTTTCTGCTGCCCAGTCTTTGAGTGTAATGCATCTACATTCTGAGTGACGAGCCAGTGCAGCTTTCCCTTTTCCTCCCAGTCTCGTAATGCGAAGTGCGCTGGATTCGGCTGGTGTGAGGAGAACTGAGGCCACCCCATGTAGTTCCGGGCCCAGTATCGTTGCCTAGATTTCGCACTGCGCACAAACTCTGAGTGTTGCATCGGCCGCCTGTCTGTCCGTGCATACAGCCCCACACCTTCTGATCTGTAGTCTGGAATCCCAGATTCAGTGGAGAGTCCGGCACCGCTTATCACAAACAGACGAGAAGCCTGCGACACAAAGGCCTGGACTTGTTCCAAAGCACTGGAGTCAATTGAGCCACTTGCAGGAACAAATCTTTGCACACTAGCTTGTACTGTAGAGGCACATCTTCCTACTGCCACACGAGGAGGCACGGATCTCCATGAAAGCAGCATCTACAAACCTGATCAGA

Function


symbol description
sirt4 Predicted to enable several functions, including NAD+ binding activity; acyltransferase activity, transferring groups other than amino-acyl groups; and zinc ion binding activity. Predicted to be involved in protein ADP-ribosylation and protein deacetylation. Predicted to be located in mitochondrial matrix. Is expressed in liver and retina. Orthologous to human SIRT4 (sirtuin 4).

NR:

description
PREDICTED: NAD-dependent protein lipoamidase sirtuin-4, mitochondrial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU69226 True 489 lncRNA 0.52 1 20008095 20008583

Neighbor


gene id symbol gene type direction distance location
c6h1orf74 LOC107712101,LOC107584438,LOC107568182,LOC107721171,LOC107667327,LOC107673551 coding upstream 2135 20004804 ~ 20005960 (+)
ruvbl1 ruvbl1,LOC107673590,LOC107721190,LOC107568195,LOC107667375,LOC107712098,LOC107584430 coding upstream 8967 19995035 ~ 19999128 (+)
gata2b gata2b,LOC107712071,LOC107673559,LOC107584431,LOC107721170,LOC107667331,LOC107568181 coding upstream 25352 19977071 ~ 19982743 (+)
si:ch211-157b11.8 si:ch211-157b11.8,LOC107712072,LOC107584432,LOC107673560 coding upstream 35662 19966623 ~ 19972433 (+)
slc26a6l slc26a6l,LOC107712095,LOC107673476,LOC107584419 coding upstream 79751 19922524 ~ 19928344 (+)
eif4enif1 eif4enif1,LOC107673519,LOC107584417,LOC107667360,LOC107568191,LOC107712102 coding downstream 18344 20026927 ~ 20038497 (+)
patz1 patz1,LOC107568192,LOC107712103,LOC107584420,LOC107721193 coding downstream 30611 20039194 ~ 20050026 (+)
tgfa tgfa,LOC107712107,LOC107721172,LOC107673622 coding downstream 49047 20057630 ~ 20067203 (+)
entpd8 entpd8,LOC107673470,LOC107584429,LOC107712074,LOC107667330,LOC107567076,LOC107736630 coding downstream 70013 20078596 ~ 20084856 (+)
fkbp5 fkbp5,LOC107673486,LOC107712109,LOC107667344,LOC107721196,LOC107584436,LOC108413698,LOC108271732 coding downstream 96839 20105422 ~ 20115234 (+)
G46733 sirt4,LOC107584486,LOC107712059,LOC107568197,LOC107721201,LOC107667314 non-coding upstream 118 20007703 ~ 20007977 (+)
G46731 NA non-coding upstream 752 20006164 ~ 20007343 (+)
G46726 NA non-coding upstream 8397 19991671 ~ 19999698 (+)
G46722 LOC107673562,LOC107584441,LOC105017189 non-coding upstream 41629 19965259 ~ 19966466 (+)
G46690 NA non-coding upstream 46110 19961209 ~ 19961985 (+)
G46750 NA non-coding downstream 7982 20016565 ~ 20016863 (+)
G46751 NA non-coding downstream 9732 20018315 ~ 20018679 (+)
G46752 LOC107712061 non-coding downstream 10246 20018829 ~ 20019302 (+)
G46753 NA non-coding downstream 12601 20021184 ~ 20021709 (+)
G46754 NA non-coding downstream 13700 20022283 ~ 20022561 (+)
slc6a11a slc6a11a,LOC108440580,LOC107673588 other upstream 134560 19866559 ~ 19873535 (+)
LOC122347202 uqcc2,cf125,LOC107580205,LOC108440614,LOC107667355,LOC106565356 other upstream 161547 19843047 ~ 19846548 (+)
ghrl LOC107585199,LOC107711011,LOC107673481 other upstream 221798 19784177 ~ 19786297 (+)
itpr1a itpr1a,LOC107748403,LOC107711046,LOC107673508,LOC107585177 other upstream 414087 19566011 ~ 19594008 (+)
si:dkey-195m11.8 si:dkey-195m11.8,LOC107585129,LOC107673511,LOC107711061,LOC107667357,LOC107733585,LOC107582701,LOC107711063,LOC107673480,LOC107733603,LOC107582828,LOC107667335,LOC107579851 other upstream 660466 19262584 ~ 19347629 (+)
G46742 NA other downstream 78508 20087091 ~ 20095641 (+)
LOC122346811 rad18,LOC107673612,LOC107657944,LOC107567093,LOC107584494 other downstream 623387 20631970 ~ 20661207 (+)
LOC122347404 rad18,LOC107673612,LOC107657944,LOC107567093,LOC107584494,LOC107712119 other downstream 711834 20720417 ~ 20749398 (+)
oxtra oxtr,LOC107584509,LOC107673460,LOC107658098 other downstream 766415 20774998 ~ 20786533 (+)
G47187 cpt1b,LOC107559523,LOC107710383,LOC107686536,LOC107671150,LOC107599889 other downstream 1766825 21775408 ~ 21777713 (+)

Expression



Co-expression Network