G25712



Basic Information


Item Value
gene id G25712
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 1753239 ~ 1753460 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU29025
TAAGACTTTTGTTCATCTTCGGAAAACAAATGAAGATATTTTTTATGAAATCTGAGAGCTTTCTGTCCCTCCATTAACAGCCTACGCAACTACCACTTTCAAGCCCTAGAAAGGTAGTAAAGGCATCATTAAAGTAATCCATGTGACTCCAGTGGTTTAACCTCAATTTTATGAAACGATGTGAGTGCTTTTCATTTGTGCCAAAAAACAAACAAACATAAT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU29025 True 222 lncRNA 0.46 1 1753239 1753460
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000004_01626984_01627238 NA coding downstream 126001 1626216 ~ 1627238 (-)
CI01000004_01605140_01622364 NA coding downstream 130875 1604552 ~ 1622364 (-)
CI01000004_01554696_01564701 NA coding downstream 188538 1554656 ~ 1564701 (-)
CI01000004_01440447_01443088 NA coding downstream 309947 1439771 ~ 1443292 (-)
CI01000004_01404265_01425424 NA coding downstream 327815 1404265 ~ 1425424 (-)
CI01000004_01758554_01762415 NA coding upstream 4962 1758422 ~ 1762415 (-)
CI01000004_01773383_01774888 INSL5B coding upstream 19468 1772928 ~ 1774942 (-)
CI01000004_01814534_01821755 CMPK1, CMPK coding upstream 60322 1813782 ~ 1821755 (-)
CI01000004_01833090_01839923 SLC35A3B, SLC35A3 coding upstream 79554 1833014 ~ 1839923 (-)
CI01000004_01853673_01854481 NA coding upstream 99728 1853188 ~ 1855232 (-)
G25700 NA non-coding downstream 22616 1728532 ~ 1730623 (-)
G25690 NA non-coding downstream 61178 1691294 ~ 1692061 (-)
G25672 NA non-coding downstream 62402 1689359 ~ 1690837 (-)
G25687 NA non-coding downstream 67031 1685172 ~ 1686208 (-)
G25689 NA non-coding downstream 68600 1683373 ~ 1684639 (-)
G25661 NA non-coding upstream 2078 1755538 ~ 1757321 (-)
G25666 NA non-coding upstream 151853 1905313 ~ 1907541 (-)
G25744 NA non-coding upstream 156830 1910290 ~ 1910523 (-)
G25642 NA non-coding upstream 183739 1937199 ~ 1944111 (-)
G25640 NA non-coding upstream 262797 2016257 ~ 2018609 (-)
G26788 NA other upstream 1520973 3267683 ~ 3275721 (-)
G27746 NA other upstream 3424767 5178227 ~ 5203724 (-)
CI01000004_05617072_05627369 NA other upstream 3866923 5616644 ~ 5628289 (-)
CI01000004_06539836_06541252 NA other upstream 4781367 6538904 ~ 6541252 (-)

Expression


G25712 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G25712 Expression in each Bioproject

Bar chart with 36 bars.
G25712 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network