G26568


Basic Information

Item Value
gene id G26568
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 2484232 ~ 2485163 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU29967
CAATATCATACGTTAAAGTTGTGTGGGGTGGCAGTAAATTAAGTGCGATCTGCTGTGACGTCACAATCATGGTGCATTGTGGTCTATGGATCTGCCTGAAGTGTAGACTCGCACCCTCTGTCAAAATCGAGGGGTCGAGGGTCTGTCCAAATAAACTTCCCTCATCCAGTTGACGAAGTTGAATGCACTTCAAAATGGCAGTGAGGATTCCCCCGAAGGGGAAATGCTTAAATAGGGAAGTTTGTGAAAAATTGACATCAAGAATTTTAGATCCTGTGTTTAAGTCCACCAAAATCCATAAATGCCAAAGAATAACAGATAATTATGTTTTAACTAACTTCCGGTGCACCAAATCTCTAAAGATGTCTCAGATTTTATTGGTTAAAAGCATTGGCCCTTAGATGAATTCAGCAGCACTGACAGAAGCTGTGCACTTTCTATATAAAACAGTAGAGAACAGGAAAGCGGTTCTAAAAAGAAACTAAACCACCATAAACCAGTGTCACTCAAAATCTAAACAGAACTGCTGCTCAAAATGGATACAGTTATGTACAAGGTAGGTACATAAAGGTTATTGCATATTGACCTACATGCATTTACGGAAAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU29967 True 606 lncRNA 0.39 2 2484232 2485163
Loading

Neighbor

gene id symbol gene type direction distance location
CI01000004_02458156_02458869 NA coding downstream 25270 2457795 ~ 2458962 (-)
CI01000004_02245903_02355814 KMT2CB coding downstream 128042 2245903 ~ 2356190 (-)
CI01000004_02198207_02227474 PRKAG2A, PRKAG2B, PRKAG2 coding downstream 256758 2197584 ~ 2227474 (-)
CI01000004_02137991_02139934 NA coding downstream 344298 2137366 ~ 2140890 (-)
CI01000004_02074726_02085013 NMUR1B coding downstream 399128 2074485 ~ 2085104 (-)
CI01000004_02571511_02598869 ARHGAP21B coding upstream 86148 2571311 ~ 2600082 (-)
CI01000004_02608555_02621378 NA coding upstream 123000 2608163 ~ 2621378 (-)
CI01000004_02638015_02638848 NA coding upstream 152671 2629744 ~ 2639335 (-)
CI01000004_02664483_02667653 PRTFDC1 coding upstream 179320 2664483 ~ 2667653 (-)
CI01000004_02777722_02810321 CDC73.S, CDC73 coding upstream 292559 2777722 ~ 2810321 (-)
G26544 NA non-coding downstream 27516 2456411 ~ 2456716 (-)
G26541 NA non-coding downstream 32147 2451869 ~ 2452085 (-)
G26538 NA non-coding downstream 38420 2445605 ~ 2445812 (-)
G26529 NA non-coding downstream 65576 2416891 ~ 2418656 (-)
G25862 NA non-coding downstream 76877 2407084 ~ 2407355 (-)
G26609 NA non-coding upstream 185150 2670313 ~ 2671760 (-)
G26635 NA non-coding upstream 245760 2730923 ~ 2731238 (-)
G26636 NA non-coding upstream 250432 2735595 ~ 2735829 (-)
G26656 NA non-coding upstream 406665 2891828 ~ 2892300 (-)
CI01000004_01773383_01774888 INSL5B other downstream 709291 1772928 ~ 1774942 (-)
G26788 NA other upstream 789270 3267683 ~ 3275721 (-)
G27746 NA other upstream 2693064 5178227 ~ 5203724 (-)
CI01000004_05617072_05627369 NA other upstream 3135220 5616644 ~ 5628289 (-)
CI01000004_06539836_06541252 NA other upstream 4049664 6538904 ~ 6541252 (-)
G29388 NA other upstream 4146130 6631293 ~ 6631907 (-)

Expression

G26568 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G26568 Expression in each Bioproject

Bar chart with 8 bars.
G26568 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network