G25992



Basic Information


Item Value
gene id G25992
gene name NA
gene type unknown
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 2736536 ~ 2736768 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU29329
GACCGAATGATGCAGGAGGTGGCTTTGGAGGAGGACGGCCAACTGGGAGGAGTAGCCAGATGGTGGCCCAGGCCACAGCCAGGATGGTGGATCACGGCAGCAGCGCTGGAGGGAGGAGCCATGGTGGTGAAGGCTTCAGCGCCGCCTCGGGAACGAGCGAGGTCGACGGCGATGATGGAGGAGGAACCCACGGCACAGATGGAGGGCTGATGGAGTGGAGTGACGCTGAAGAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU29329 True 233 TUCP 0.64 1 2736536 2736768
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000004_02671199_02727898 GPR158B coding upstream 8208 2671199 ~ 2728328 (+)
CI01000004_02528689_02568243 NA coding upstream 167309 2528689 ~ 2569227 (+)
CI01000004_02143355_02186281 BCL2B coding upstream 549765 2142676 ~ 2186771 (+)
CI01000004_02126757_02136937 KDSR coding upstream 599188 2126466 ~ 2137348 (+)
CI01000004_02116310_02120268 VPS4B coding upstream 616176 2115937 ~ 2120360 (+)
CI01000004_02745885_02768971 NA coding downstream 9117 2745885 ~ 2769135 (+)
CI01000004_02865415_02867952 NA coding downstream 128085 2864853 ~ 2868369 (+)
CI01000004_02903759_02904287 NA coding downstream 166991 2903759 ~ 2904324 (+)
CI01000004_02906581_02908320 IMPAD1 coding downstream 169711 2906479 ~ 2908320 (+)
CI01000004_02948465_02951235 PENKA coding downstream 210448 2947216 ~ 2951743 (+)
G25884 NA non-coding upstream 90874 2644190 ~ 2645662 (+)
G25914 NA non-coding upstream 124068 2611213 ~ 2612468 (+)
G25885 NA non-coding upstream 209708 2482508 ~ 2526828 (+)
G25871 NA non-coding upstream 254179 2474371 ~ 2482357 (+)
G25873 NA non-coding upstream 262342 2459864 ~ 2474194 (+)
G26014 NA non-coding downstream 34873 2771641 ~ 2771878 (+)
G26015 NA non-coding downstream 37537 2774305 ~ 2774560 (+)
G26017 NA non-coding downstream 38802 2775570 ~ 2775981 (+)
G25982 NA non-coding downstream 39601 2776369 ~ 2777255 (+)
G25986 NA non-coding downstream 40986 2777754 ~ 2779182 (+)
G25882 NA other upstream 163487 2548075 ~ 2573049 (+)
G25329 NA other upstream 650829 2083057 ~ 2085707 (+)
CI01000004_01867166_01868986 C7H1ORF21 other upstream 863178 1867166 ~ 1868986 (+)
G25187 NA other upstream 1120066 1604542 ~ 1616470 (+)
CI01000004_01332533_01345585 SCP2 other upstream 1388362 1331583 ~ 1346008 (+)
G26245 NA other downstream 772249 3509017 ~ 3522393 (+)
CI01000004_03550525_03552621 PTGER4C other downstream 814280 3550329 ~ 3553423 (+)
G27805 NA other downstream 2636057 5372825 ~ 5373803 (+)
G28165 NA other downstream 2995821 5732589 ~ 5733001 (+)

Expression


G25992 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

G25992 Expression in each Bioproject

Bar chart with 21 bars.
G25992 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network