LOC122346791 (slc6a11a,LOC107673588,LOC108440580)


Basic Information

Item Value
gene id LOC122346791
gene name slc6a11a,LOC107673588,LOC108440580
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056704.1
NCBI id CM032073.1
chromosome length 27473687
location 20245708 ~ 20247348 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XR_006251169.1
TTTCATTCCATATGTCCTGTACCTGCTCACTTGTGGTATCCCACTTTTTGTGCTCGAGACGTCTTTGGGTCAGTACACCAGTCAGGGAGGCATCACATGTTGGAGAAAGATCTGTCCTCTTTTTGAAGGAATGGGTTATGCCAGTCAAATTATTATTGTCTATGGCTCAATTACCTACATCATCATCATAGTCTGGGCCTTCCTGTACCTTTTCTCAGCCTTCAGTGTGGAACTGCCCTGGGCCAGCTGCAGCAATCTGTGGAACACAGATGCTTGTATAGTGCTTAGTGTGAAGAATTCTAGCTCAGGGTGGACGTCTCCTCTCAACGCTTCTTCCTCTGTGATGGAATTCTGGCG

Function

symbol description
slc6a11a Predicted to enable gamma-aminobutyric acid:sodium symporter activity. Predicted to be involved in sodium ion transmembrane transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in neuron projection. Predicted to be integral component of plasma membrane. Is expressed in ectoderm. Orthologous to several human genes including SLC6A13 (solute carrier family 6 member 13).

NR:

description
PREDICTED: sodium- and chloride-dependent GABA transporter 2-like

GO:

id name namespace
GO:0006836 neurotransmitter transport biological_process
GO:0035725 sodium ion transmembrane transport biological_process
GO:0016021 integral component of membrane cellular_component
GO:0005328 neurotransmitter molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XR_006251169.1 True 357 lncRNA 0.47 3 20245708 20247348

Neighbor

gene id symbol gene type direction distance location
LOC122347299 LOC107683669,LOC107709781,LOC107701556,LOC107709782,LOC107704729,LOC107585716,LOC107739789,LOC107585717,LOC107585718 coding downstream 7048 20237274 ~ 20238660 (-)
slc6a22.1 slc6a13,LOC107584422,LOC107567077,LOC107721195,LOC107712063,LOC108413697 coding downstream 120447 20116875 ~ 20125261 (-)
rab44 NA coding downstream 150191 20084841 ~ 20095517 (-)
trub2 LOC107712105,LOC107673580,LOC107584434,LOC107721199,LOC107569306,LOC107568203,LOC107584444 coding downstream 172211 20070910 ~ 20073497 (-)
hdhd3 hdhd3,LOC107712106,LOC107584439,LOC107673581,LOC107667329 coding downstream 175501 20068870 ~ 20070207 (-)
hemk1 LOC107750260,LOC107712066,LOC107657999,LOC107567089,LOC107584453 coding upstream 176363 20423711 ~ 20431177 (-)
cav3 cav3,LOC107749619,LOC107584510,LOC107750282,LOC107658089,LOC107577493,LOC107673475 coding upstream 535096 20782444 ~ 20786555 (-)
gpr61l LOC107658083,LOC107750281,LOC107749617,LOC107567083,LOC107584511,LOC107673479 coding upstream 547898 20795246 ~ 20799151 (-)
parp3 parp3,LOC107749614,LOC107750280,LOC107658076,LOC107673445 coding upstream 552746 20800094 ~ 20805651 (-)
grm2a grm2a,grm2,LOC107673619,LOC107657935,LOC107567094,LOC107749615,LOC107750271,LOC107584497 coding upstream 559415 20806763 ~ 20841391 (-)
LOC122347561 NA non-coding downstream 5272 20239802 ~ 20240436 (-)
G46842 NA non-coding downstream 71417 20173538 ~ 20174291 (-)
G46838 NA non-coding downstream 92921 20149547 ~ 20152787 (-)
G46836 NA non-coding downstream 115869 20127948 ~ 20129839 (-)
G46816 fkbp5,LOC107584436,LOC107712109,LOC107673486,LOC107721196,LOC107667344 non-coding downstream 130449 20054866 ~ 20115259 (-)
G46870 NA non-coding upstream 31943 20279291 ~ 20399625 (-)
G46872 NA non-coding upstream 39067 20286415 ~ 20287172 (-)
G46875 NA non-coding upstream 80736 20328084 ~ 20378235 (-)
G46877 NA non-coding upstream 84064 20331412 ~ 20394142 (-)
G46879 NA non-coding upstream 92692 20340040 ~ 20389396 (-)
G46840 synpr,LOC107658112,LOC107673482,LOC107584506,LOC107712113,LOC107567085,LOC108436247 other downstream 79429 20161440 ~ 20166279 (-)
srsf3a LOC107712108,LOC107584442,LOC107673487,LOC107721197,LOC107667402 other downstream 143249 20096024 ~ 20102459 (-)
mustn1a mustn1a other downstream 245070 19998632 ~ 20000638 (-)
LOC122347177 LOC107584418 other downstream 288978 19899672 ~ 19956730 (-)
tspo tspo,LOC107721166,LOC107568174,LOC107584504,LOC107667354,LOC107673503 other downstream 398276 19843044 ~ 19847432 (-)
G46926 NA other upstream 281831 20529179 ~ 20531834 (-)
mdfic2 LOC107667017,LOC107713509,LOC107584472,LOC107680698,LOC107599432 other upstream 1101271 21348619 ~ 21355381 (-)
tardbpb tardbp,LOC107713527,LOC107555974,LOC107666995,LOC107680706,LOC107561006 other upstream 2492624 22739972 ~ 22750947 (-)
G47535 LOC102793276,LOC101471251,LOC100701884,LOC102312415,LOC102199361 other upstream 2874435 23121783 ~ 23163157 (-)
G47590 NA other upstream 3152001 23399349 ~ 23400502 (-)

Expression


Co-expression Network