trnaa-ugc_26



Basic Information


Item Value
gene id trnaa-ugc_26
gene name NA
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information


Item Value
chromosome id NC_056704.1
NCBI id CM032073.1
chromosome length 27473687
location 13432204 ~ 13432275 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence


>unassigned_transcript_1126
ggggatgtagctcagtggtagagcgcatgctttgcatgtatgaggtcctgggttcaatccccagcatctcca

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
unassigned_transcript_1126 True 72 tRNA 0.54 1 13432204 13432275
Loading

Neighbor


gene id symbol gene type direction distance location
trnaa-ugc_25 NA coding downstream 303 13431830 ~ 13431901 (-)
trnaa-ugc_24 NA coding downstream 484 13431649 ~ 13431720 (-)
trnaa-ugc_23 NA coding downstream 1141 13430992 ~ 13431063 (-)
trnaa-cgc_8 NA coding downstream 1323 13430810 ~ 13430881 (-)
trnaa-ugc_22 NA coding downstream 1615 13430518 ~ 13430589 (-)
trnaa-ugc_27 NA coding upstream 283 13432558 ~ 13432629 (-)
trnaa-ugc_28 NA coding upstream 463 13432738 ~ 13432809 (-)
trnaa-ugc_29 NA coding upstream 822 13433097 ~ 13433168 (-)
trnaa-ugc_30 NA coding upstream 1134 13433409 ~ 13433480 (-)
trnaa-ugc_31 NA coding upstream 1323 13433598 ~ 13433669 (-)
G44942 NA non-coding downstream 74683 13356987 ~ 13357521 (-)
G44941 NA non-coding downstream 77421 13354307 ~ 13354783 (-)
G44940 NA non-coding downstream 78024 13353915 ~ 13354180 (-)
G44939 NA non-coding downstream 78554 13353364 ~ 13353650 (-)
G44938 NA non-coding downstream 79135 13352462 ~ 13353069 (-)
G45014 NA non-coding upstream 104669 13536944 ~ 13611593 (-)
G45036 NA non-coding upstream 261063 13693338 ~ 13694164 (-)
G45039 NA non-coding upstream 265224 13697499 ~ 13697711 (-)
LOC122347350 NA non-coding upstream 391397 13823672 ~ 13835591 (-)
G45058 NA non-coding upstream 405030 13837305 ~ 13837538 (-)
LOC122347614 rab6ba,rab6b,LOC107696768,LOC107552273,LOC102207753,LOC100696791,LOC107694122,LOC103354239 other downstream 534486 12525756 ~ 12897718 (-)
brdt brdt,LOC107678354,LOC107749988,LOC107675431,LOC107730697,LOC107564432 other downstream 2362738 11055035 ~ 11069466 (-)
gng12b LOC107555383,LOC107678346,LOC107705318,LOC107564436,LOC105895117,LOC108271932 other downstream 2447072 10948692 ~ 10985132 (-)
ntn1a ntn1a,LOC107555375,LOC107704007,LOC107733905,LOC107569361,LOC107757426,LOC107660463,LOC105903456,LOC106587088,LOC105012279 other downstream 2596679 10578989 ~ 10835525 (-)
tmem131 tmem131,LOC107659030,LOC107692350,LOC107732007 other upstream 222985 13655260 ~ 13681294 (-)
pex5la pex5la,LOC107709207,LOC107590632,LOC107659033,LOC107692357,LOC107548659,LOC107732026 other upstream 285927 13718202 ~ 13785903 (-)
G45257 ttc22,LOC107590622,LOC107692368,LOC107659045,LOC107591163 other upstream 728200 14160475 ~ 14193166 (-)
LOC122347580 ttc4,LOC107738930,LOC107659046,LOC107709194,LOC107692369 other upstream 1895308 15327583 ~ 15330851 (-)
insl5a LOC107692440 other upstream 2056843 15489118 ~ 15490685 (-)

Expression


trnaa-ugc_26 Expression in all Baseline Samples

Bar chart with 10 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network