G26837


Basic Information

Item Value
gene id G26837
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 3355215 ~ 3355472 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU30289
TCCTCTCTCAAGATCCATAAAGGTACTAAAAACATATTTAAATCAGTTCATGTGAGTACAGTGGTTCAATTTTAATATTATAAAGCGACGAGAATATTTTGGTGCGCCAAAAAAACAAAATAACGACTTATTTAGTGATGGCCGATTTCAAACCGCTGCTTCAGGAAGCTTCGGAGCATAATGATTCAGCGTGTCGAATCAAGGAAATGTCATTGCTGGCTATGTAGGCCTCACAGAGTCATCGGATTTCAACAAAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU30289 True 258 lncRNA 0.38 1 3355215 3355472

Neighbor

gene id symbol gene type direction distance location
CI01000004_03277921_03285364 FAM69AA, FAM69A coding downstream 69851 3277741 ~ 3285364 (-)
CI01000004_03244252_03265862 EVI5 coding downstream 89168 3243903 ~ 3266047 (-)
CI01000004_03238528_03240932 GFI1AA, GFI1 coding downstream 113724 3238358 ~ 3241491 (-)
CI01000004_03214098_03222707 GLMNA, GLMN coding downstream 132508 3214098 ~ 3222707 (-)
CI01000004_03204599_03205569 TCEANC2 coding downstream 149147 3204572 ~ 3206068 (-)
CI01000004_03433963_03436906 GADD45A, GADD45AA coding upstream 78360 3433832 ~ 3436906 (-)
CI01000004_03475454_03478135 NA coding upstream 119422 3474894 ~ 3479485 (-)
CI01000004_03505898_03508656 NSUN4 coding upstream 150326 3505798 ~ 3508770 (-)
CI01000004_03514180_03525227 PIF1 coding upstream 158201 3513673 ~ 3525582 (-)
CI01000004_03556991_03559357 ARTN coding upstream 201010 3556482 ~ 3559357 (-)
G26811 NA non-coding downstream 50 3342814 ~ 3355165 (-)
G26803 NA non-coding downstream 3291 3346000 ~ 3351924 (-)
G26812 NA non-coding downstream 22972 3330745 ~ 3332243 (-)
G26810 NA non-coding downstream 48790 3300799 ~ 3306425 (-)
G26788 NA non-coding downstream 79494 3267683 ~ 3275721 (-)
G26854 NA non-coding upstream 50931 3406403 ~ 3406827 (-)
G26924 NA non-coding upstream 193002 3548474 ~ 3548695 (-)
G26948 NA non-coding upstream 302082 3657554 ~ 3657869 (-)
G26955 NA non-coding upstream 317467 3672939 ~ 3673155 (-)
G26902 NA non-coding upstream 463711 3819183 ~ 3929949 (-)
CI01000004_01773383_01774888 INSL5B other downstream 1580274 1772928 ~ 1774942 (-)
G27746 NA other upstream 1822755 5178227 ~ 5203724 (-)
CI01000004_05617072_05627369 NA other upstream 2264911 5616644 ~ 5628289 (-)
CI01000004_06539836_06541252 NA other upstream 3179355 6538904 ~ 6541252 (-)
G29388 NA other upstream 3275821 6631293 ~ 6631907 (-)
G29656 NA other upstream 4608892 7964364 ~ 7965500 (-)

Expression


Co-expression Network