G26948



Basic Information


Item Value
gene id G26948
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 3657554 ~ 3657869 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU30421
ATTCATTTGGGATACGGAAGCCGAGAGATTTTTCAACAATGGCTGTGTCCCAATTCAGGGGCTGCACCCTTTGAAGGCTGCATACATCATCGAGGCAGTCTCATTTAAGAAAAATAACTGTTAGATTGCAACATAAGAAAGAAATTACAGTATTTTACACCTCACAATGAATATCGGTCAATTTTATTACGGTTACTTTTCTTAAATAAGACATCCTTGATGACGTATGCAGCCTTCAAATGCGACCTCCGGAGGACATAGCCTCTGAAATGAGACGCAGCTCCTGTCAACAAAGGAGTGTGTTTTTGATTGTGAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU30421 True 316 lncRNA 0.43 1 3657554 3657869
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000004_03612407_03645686 ST3GAL3B coding downstream 10090 3611978 ~ 3647464 (-)
CI01000004_03594612_03595116 NA coding downstream 62413 3594133 ~ 3595141 (-)
CI01000004_03588875_03589130 NA coding downstream 68301 3587976 ~ 3589253 (-)
CI01000004_03559459_03560064 NA coding downstream 97490 3559459 ~ 3560064 (-)
CI01000004_03556991_03559357 ARTN coding downstream 98197 3556482 ~ 3559357 (-)
CI01000004_03681226_03695729 KDM4AB, KDM4A coding upstream 23239 3681108 ~ 3696553 (-)
CI01000004_03705008_03734116 NA coding upstream 46274 3704143 ~ 3735494 (-)
CI01000004_03737431_03794978 PTPRFB, PTPRF coding upstream 79501 3737370 ~ 3795450 (-)
CI01000004_03802203_03806124 NA coding upstream 143267 3801136 ~ 3807171 (-)
CI01000004_04062573_04103207 NA coding upstream 403328 4061197 ~ 4103361 (-)
G26924 NA non-coding downstream 108859 3548474 ~ 3548695 (-)
G26854 NA non-coding downstream 250727 3406403 ~ 3406827 (-)
G26837 NA non-coding downstream 302082 3355215 ~ 3355472 (-)
G26811 NA non-coding downstream 302389 3342814 ~ 3355165 (-)
G26803 NA non-coding downstream 305630 3346000 ~ 3351924 (-)
G26955 NA non-coding upstream 15070 3672939 ~ 3673155 (-)
G26902 NA non-coding upstream 161314 3819183 ~ 3929949 (-)
G26889 NA non-coding upstream 226496 3884365 ~ 3907456 (-)
G26983 NA non-coding upstream 298875 3956744 ~ 3956954 (-)
G26992 NA non-coding upstream 320737 3978606 ~ 3978816 (-)
G26788 NA other downstream 381833 3267683 ~ 3275721 (-)
CI01000004_01773383_01774888 INSL5B other downstream 1882613 1772928 ~ 1774942 (-)
G27746 NA other upstream 1520358 5178227 ~ 5203724 (-)
CI01000004_05617072_05627369 NA other upstream 1962514 5616644 ~ 5628289 (-)
CI01000004_06539836_06541252 NA other upstream 2876958 6538904 ~ 6541252 (-)
G29388 NA other upstream 2973424 6631293 ~ 6631907 (-)
G29656 NA other upstream 4306495 7964364 ~ 7965500 (-)

Expression


G26948 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G26948 Expression in each Bioproject

Bar chart with 42 bars.
G26948 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2000.
End of interactive chart.

Co-expression Network