G26359



Basic Information


Item Value
gene id G26359
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 3673032 ~ 3673247 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU29747
ATTTGGTCATTATGTAATTATATTGATAGTAGTTGGCCACCGGAGTCAGTCAGACTAAAATAGCTAGCGATGTCGCTAGTTAGCTGTGAAAGTTGAGACACGAGTTTACATGACTTCTATATAGTTTTAGCTTATATTATATCTTATTTTATAAACTAAATTTCCTTAAGTTTAAATATGCATCTTTATTTTCTTAAAACCAACTTTTATGACAAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU29747 True 216 lncRNA 0.30 1 3673032 3673247
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000004_03592655_03592917 NA coding upstream 80115 3592655 ~ 3592917 (+)
CI01000004_03550525_03552621 PTGER4C coding upstream 119609 3550329 ~ 3553423 (+)
CI01000004_03504401_03504700 NA coding upstream 168100 3504278 ~ 3504932 (+)
CI01000004_03496175_03497985 DMBX1, DMBX1A coding upstream 174648 3494746 ~ 3498384 (+)
CI01000004_03432787_03433110 NA coding upstream 239578 3432787 ~ 3433454 (+)
CI01000004_03735876_03736152 NA coding downstream 62507 3735754 ~ 3737017 (+)
CI01000004_03814120_03839793 NA coding downstream 140804 3814051 ~ 3839807 (+)
CI01000004_03878083_03909016 NA coding downstream 204772 3878019 ~ 3909309 (+)
CI01000004_03934726_03935639 NA coding downstream 260438 3933685 ~ 3935870 (+)
CI01000004_04048829_04053849 NA coding downstream 372681 4045928 ~ 4054570 (+)
G26354 NA non-coding upstream 5820 3666932 ~ 3667212 (+)
G26349 NA non-coding upstream 17005 3655813 ~ 3656027 (+)
G26233 NA non-coding upstream 83845 3586835 ~ 3589187 (+)
G26276 NA non-coding upstream 86575 3585785 ~ 3586457 (+)
G26317 NA non-coding upstream 90267 3582544 ~ 3582765 (+)
G26263 NA non-coding downstream 3156 3676403 ~ 3676745 (+)
G26244 NA non-coding downstream 6474 3679721 ~ 3681358 (+)
G26362 NA non-coding downstream 28909 3702156 ~ 3702634 (+)
G26390 NA non-coding downstream 127663 3800910 ~ 3802844 (+)
G26416 NA non-coding downstream 167585 3840832 ~ 3842544 (+)
G26245 NA other upstream 150639 3509017 ~ 3522393 (+)
CI01000004_02745885_02768971 NA other upstream 914094 2745885 ~ 2769135 (+)
G25992 NA other upstream 936264 2736536 ~ 2736768 (+)
G25882 NA other upstream 1099983 2548075 ~ 2573049 (+)
G27805 NA other downstream 1699578 5372825 ~ 5373803 (+)
G28165 NA other downstream 2059342 5732589 ~ 5733001 (+)
G28302 NA other downstream 2796781 6470028 ~ 6502087 (+)
CI01000004_06571261_06572539 SEP15 other downstream 2897973 6570771 ~ 6572667 (+)
CI01000004_07654234_07655677 MRPL34 other downstream 3981525 7654234 ~ 7656383 (+)

Expression


G26359 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G26359 Expression in each Bioproject

Bar chart with 33 bars.
G26359 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network