G26983



Basic Information


Item Value
gene id G26983
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 3956744 ~ 3956954 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU30456
TCTGCCCTCACCAAGGATTCCCTCCAGCTCTCCGGCTCTGCCTCTGCTCTTCTCTCCACCAGCTCGGCTCTGCAAGACGGATCCCCTGGCTTCACCTCGGACCTCGGAGTCAGTGAAAACAGTAATATTTTGGAATATTATTACAATTTAAAACAGCTGTTCTGTATATATTACATGCTGAAAATTCAGCTTTGCCAACATAGAAATAAAT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU30456 True 211 lncRNA 0.45 1 3956744 3956954

Neighbor


gene id symbol gene type direction distance location
CI01000004_03802203_03806124 NA coding downstream 149573 3801136 ~ 3807171 (-)
CI01000004_03737431_03794978 PTPRFB, PTPRF coding downstream 161294 3737370 ~ 3795450 (-)
CI01000004_03705008_03734116 NA coding downstream 221250 3704143 ~ 3735494 (-)
CI01000004_03681226_03695729 KDM4AB, KDM4A coding downstream 260191 3681108 ~ 3696553 (-)
CI01000004_03612407_03645686 ST3GAL3B coding downstream 309280 3611978 ~ 3647464 (-)
CI01000004_04062573_04103207 NA coding upstream 104243 4061197 ~ 4103361 (-)
CI01000004_04177460_04183900 PBX1A, PBX1B, PBX1 coding upstream 220506 4177460 ~ 4183993 (-)
CI01000004_04241031_04243866 PBX1A coding upstream 283288 4240242 ~ 4244611 (-)
CI01000004_04267237_04294023 NA coding upstream 309772 4266726 ~ 4294110 (-)
CI01000004_04361874_04362518 NA coding upstream 404707 4361661 ~ 4362716 (-)
G26902 NA non-coding downstream 26795 3819183 ~ 3929949 (-)
G26889 NA non-coding downstream 49288 3884365 ~ 3907456 (-)
G26955 NA non-coding downstream 283589 3672939 ~ 3673155 (-)
G26948 NA non-coding downstream 298875 3657554 ~ 3657869 (-)
G26924 NA non-coding downstream 408049 3548474 ~ 3548695 (-)
G26992 NA non-coding upstream 21652 3978606 ~ 3978816 (-)
G26995 NA non-coding upstream 31289 3988243 ~ 3988560 (-)
G27425 NA non-coding upstream 142266 4099220 ~ 4099538 (-)
G27456 NA non-coding upstream 197198 4154152 ~ 4154379 (-)
G26788 NA other downstream 681023 3267683 ~ 3275721 (-)
CI01000004_01773383_01774888 INSL5B other downstream 2181803 1772928 ~ 1774942 (-)
G27746 NA other upstream 1221273 5178227 ~ 5203724 (-)
CI01000004_05617072_05627369 NA other upstream 1663429 5616644 ~ 5628289 (-)
CI01000004_06539836_06541252 NA other upstream 2577873 6538904 ~ 6541252 (-)
G29388 NA other upstream 2674339 6631293 ~ 6631907 (-)
G29656 NA other upstream 4007410 7964364 ~ 7965500 (-)

Expression



Co-expression Network