G29130


Basic Information

Item Value
gene id G29130
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 5838097 ~ 5838302 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU32948
CTTCTTTATAAGGTTTTAGATATTAGGTTTATTGGTAACCCATTGTTAAATGAATGAGATTTTTAAAAATTGACAAGCACTGTTTTCTTTCCTGTGCTGATGTATTTCCTTTTGAAATGGGAAGTTTGGACAGGACATATCATAGGGCATGTCCCTTTAAAAAACTGCCAGTAGACTTCAGTTGTCACAGCTATGACCACAATTTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU32948 True 206 lncRNA 0.53 1 5838097 5838302

Neighbor

gene id symbol gene type direction distance location
CI01000004_05803106_05809498 NA coding downstream 28599 5802857 ~ 5809498 (-)
CI01000004_05709639_05728550 NA coding downstream 109306 5708626 ~ 5728791 (-)
CI01000004_05617072_05627369 NA coding downstream 209808 5616644 ~ 5628289 (-)
CI01000004_05490354_05581387 DPYDB, DPYD coding downstream 256710 5490170 ~ 5581387 (-)
CI01000004_05482165_05486129 NA coding downstream 350237 5481646 ~ 5487860 (-)
CI01000004_05843593_05862033 NA coding upstream 5204 5843506 ~ 5862544 (-)
CI01000004_05902667_05905718 NA coding upstream 64353 5902655 ~ 5906852 (-)
CI01000004_05942638_05967553 TPRA coding upstream 104302 5942604 ~ 5967553 (-)
CI01000004_05976527_05978831 PDCA coding upstream 137102 5975404 ~ 5979754 (-)
CI01000004_06016711_06021356 PTGS2, PTGS2A coding upstream 178080 6016382 ~ 6021356 (-)
G29129 NA non-coding downstream 1192 5836647 ~ 5836905 (-)
G29111 NA non-coding downstream 7544 5827697 ~ 5830553 (-)
G29091 NA non-coding downstream 45399 5784288 ~ 5792698 (-)
G29089 NA non-coding downstream 55943 5781902 ~ 5782154 (-)
G29084 NA non-coding downstream 68387 5769248 ~ 5769710 (-)
G29132 NA non-coding upstream 1220 5839522 ~ 5843297 (-)
G29153 NA non-coding upstream 130176 5968478 ~ 5969129 (-)
G29172 NA non-coding upstream 206058 6044360 ~ 6045307 (-)
G29233 NA non-coding upstream 337394 6175696 ~ 6175900 (-)
G29208 NA non-coding upstream 447175 6285477 ~ 6298068 (-)
G27746 NA other downstream 634373 5178227 ~ 5203724 (-)
G26788 NA other downstream 2562376 3267683 ~ 3275721 (-)
CI01000004_01773383_01774888 INSL5B other downstream 4063156 1772928 ~ 1774942 (-)
CI01000004_06539836_06541252 NA other upstream 696525 6538904 ~ 6541252 (-)
G29388 NA other upstream 792991 6631293 ~ 6631907 (-)
G29656 NA other upstream 2126062 7964364 ~ 7965500 (-)
G29746 NA other upstream 2516196 8354498 ~ 8358127 (-)
G30316 NA other upstream 3539635 9377937 ~ 9406921 (-)

Expression


Co-expression Network