G29172


Basic Information

Item Value
gene id G29172
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 6044360 ~ 6045307 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU33009
TGGGACTAGCTTAAGTCTTGTCTGTGAAACTGGGGTATGATAATTCAGAGTGATTTTGCTTTTACTTACCTTCACATTCTGGTTCTTGGTATTGATAGGTGGATTCTTCAATACTGCCTGCAAAGCCCCCATCAGGATATGATCTGATGAGAGAATCCACCTCAGCCTCATCCGGACCTATTTGATTTTCTCCGCCGTCCTCCTCGTCGACAAACTTGTTTTCGTCGTACTCATCTATATCAACCTTTCTGAATCGATCGGATACTGTGTTCTTCGACATGGCTGGTTCAATCAATCAATTAGAAAATCCTAGTTTAAACAGAATAGTCCCAGCACTTTCAGGAAGCAGCTCGGTGCTTGTTGACTTCCGCATAGAAAGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU33009 True 380 lncRNA 0.36 2 6044360 6045307

Neighbor

gene id symbol gene type direction distance location
CI01000004_06016711_06021356 PTGS2, PTGS2A coding downstream 23004 6016382 ~ 6021356 (-)
CI01000004_05976527_05978831 PDCA coding downstream 64606 5975404 ~ 5979754 (-)
CI01000004_05942638_05967553 TPRA coding downstream 76807 5942604 ~ 5967553 (-)
CI01000004_05902667_05905718 NA coding downstream 137508 5902655 ~ 5906852 (-)
CI01000004_05843593_05862033 NA coding downstream 181816 5843506 ~ 5862544 (-)
CI01000004_06074774_06078306 RNF2.L, RNF2 coding upstream 29362 6074669 ~ 6079254 (-)
CI01000004_06121326_06137773 NA coding upstream 75979 6121286 ~ 6137773 (-)
CI01000004_06183916_06192361 MFSD12A coding upstream 137823 6183130 ~ 6193478 (-)
CI01000004_06200669_06208703 CSNK1G2, CSNK1G2A coding upstream 154439 6199746 ~ 6208703 (-)
CI01000004_06221889_06232315 MKNK2, MKNK2A coding upstream 175491 6220798 ~ 6232315 (-)
G29153 NA non-coding downstream 75231 5968478 ~ 5969129 (-)
G29132 NA non-coding downstream 201063 5839522 ~ 5843297 (-)
G29130 NA non-coding downstream 206058 5838097 ~ 5838302 (-)
G29129 NA non-coding downstream 207455 5836647 ~ 5836905 (-)
G29111 NA non-coding downstream 213807 5827697 ~ 5830553 (-)
G29233 NA non-coding upstream 130389 6175696 ~ 6175900 (-)
G29208 NA non-coding upstream 240170 6285477 ~ 6298068 (-)
G29188 NA non-coding upstream 354332 6399639 ~ 6403721 (-)
G29385 NA non-coding upstream 582267 6627574 ~ 6627791 (-)
G29386 NA non-coding upstream 582669 6627976 ~ 6628269 (-)
CI01000004_05617072_05627369 NA other downstream 416846 5616644 ~ 5628289 (-)
G27746 NA other downstream 840636 5178227 ~ 5203724 (-)
G26788 NA other downstream 2768639 3267683 ~ 3275721 (-)
CI01000004_01773383_01774888 INSL5B other downstream 4269419 1772928 ~ 1774942 (-)
CI01000004_06539836_06541252 NA other upstream 489520 6538904 ~ 6541252 (-)
G29388 NA other upstream 585986 6631293 ~ 6631907 (-)
G29656 NA other upstream 1919057 7964364 ~ 7965500 (-)
G29746 NA other upstream 2309191 8354498 ~ 8358127 (-)
G30316 NA other upstream 3332630 9377937 ~ 9406921 (-)

Expression


Co-expression Network