G29343


Basic Information

Item Value
gene id G29343
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 7387581 ~ 7387856 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU33217
AAACAACAAAAATAACTACTTTATTTAACAATTTTTCCTCTTCCCTGTCAGTCTGTTACGCAGTTGGCGCAGTGCTGCGTTTCCGTGTTTATGTCCGAACGCTGGCTCATTATTGGCTGGCTTCTGCGTTAGCATCACATGCATGCCTTGTGCTGCTTACGTGGACAGGCGTTGGCCAATACTGGGTCGCCGTTCGGACGTAGAACCTGGAAGCTGCAACAAACAGGGGAAAGATGAATTTGTTGAATAAAGTCGTTATTTTTGTTTTGTTTTTGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU33217 True 276 lncRNA 0.45 1 7387581 7387856

Neighbor

gene id symbol gene type direction distance location
CI01000004_07331060_07339831 NA coding downstream 47750 7330875 ~ 7339831 (-)
CI01000004_07327597_07330648 NA coding downstream 56933 7327597 ~ 7330648 (-)
CI01000004_07266248_07272453 CDYL coding downstream 115128 7266200 ~ 7272453 (-)
CI01000004_07256668_07257382 NA coding downstream 129101 7256365 ~ 7258480 (-)
CI01000004_07209004_07224321 RREB1B, RREB1 coding downstream 163260 7208677 ~ 7224321 (-)
CI01000004_07388945_07408147 TGFR1, TGFBR1, TGFBR1A, TGFBR1B coding upstream 605 7388461 ~ 7408147 (-)
CI01000004_07424499_07454604 COL15A1B coding upstream 35759 7423615 ~ 7454604 (-)
CI01000004_07481146_07504328 SLC12A7A coding upstream 92877 7480733 ~ 7504328 (-)
CI01000004_07606787_07617579 MYH6, MYH7, MYH6.S coding upstream 218842 7606698 ~ 7617579 (-)
CI01000004_07621014_07632760 MYH6, MYH7, VMHC, VMHCL, SMYHC2, SMYHC3 coding upstream 233069 7620925 ~ 7632760 (-)
G29334 NA non-coding downstream 184 7385073 ~ 7387397 (-)
G29511 NA non-coding downstream 64690 7322651 ~ 7322891 (-)
G29500 NA non-coding downstream 66846 7317591 ~ 7320735 (-)
G29508 NA non-coding downstream 99062 7288283 ~ 7288519 (-)
G29507 NA non-coding downstream 99450 7287915 ~ 7288131 (-)
G29568 NA non-coding upstream 142270 7530126 ~ 7530335 (-)
G29575 NA non-coding upstream 164676 7552532 ~ 7554333 (-)
G29598 NA non-coding upstream 277901 7665757 ~ 7665994 (-)
G29551 NA non-coding upstream 371802 7759658 ~ 7761020 (-)
G29544 NA non-coding upstream 387417 7775273 ~ 7780067 (-)
G29388 NA other downstream 755674 6631293 ~ 6631907 (-)
CI01000004_06539836_06541252 NA other downstream 842009 6538904 ~ 6541252 (-)
CI01000004_05617072_05627369 NA other downstream 1760067 5616644 ~ 5628289 (-)
G27746 NA other downstream 2183857 5178227 ~ 5203724 (-)
G26788 NA other downstream 4111860 3267683 ~ 3275721 (-)
G29656 NA other upstream 576508 7964364 ~ 7965500 (-)
G29746 NA other upstream 966642 8354498 ~ 8358127 (-)
G30316 NA other upstream 1990081 9377937 ~ 9406921 (-)
G31203 NA other upstream 3358581 10746437 ~ 10750641 (-)
CI01000004_11407198_11412220 ADCYAP1B, ADCYAP1 other upstream 4019609 11406957 ~ 11412907 (-)

Expression


Co-expression Network