G29556


Basic Information

Item Value
gene id G29556
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 7800447 ~ 7800752 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU33462
AAATAACAGATTTATTCAACAAATTCATCTCTTCCCTGTCAGACTTGTGTGCAGTTGACGCAGTGAACGCAGTAAACACGCTTCTGTGTTTACGTCAGAAAGCCAGCTCATTATTGGCCGGCTCTGGCGTCAACATCACACACATGAGTCGTGCTGCTCACATGAACAGAGTCTGCTAATAATGAGCCGCCGTTCTGACATAGAGCCTGAAATAGCATAGGAGAATGACAGGGGAGAGACAGATTTGTTGAATAAATTTGTTATTTTTGTTTTGTTTTTGTGTGCAAAAAATATTCTCGTCGCTTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU33462 True 306 lncRNA 0.42 1 7800447 7800752

Neighbor

gene id symbol gene type direction distance location
CI01000004_07792267_07797908 CRSP7 coding downstream 1985 7791898 ~ 7798462 (-)
CI01000004_07784930_07788318 CNN2 coding downstream 11940 7783684 ~ 7788507 (-)
CI01000004_07755406_07758041 NA coding downstream 42406 7755167 ~ 7758041 (-)
CI01000004_07751113_07751701 NA coding downstream 48692 7750451 ~ 7751755 (-)
CI01000004_07712568_07742293 KCNN1, KCNN1A, KCNN1B coding downstream 58154 7712478 ~ 7742293 (-)
CI01000004_07805884_07817962 CRTC1 coding upstream 4901 7805653 ~ 7818936 (-)
CI01000004_07829094_07830772 NA coding upstream 28251 7829003 ~ 7830813 (-)
CI01000004_07960123_07960701 NA coding upstream 159352 7958746 ~ 7961208 (-)
CI01000004_07998445_08008810 HLTF coding upstream 197481 7997249 ~ 8008810 (-)
CI01000004_08010634_08013275 NCK1A coding upstream 209107 8009859 ~ 8013275 (-)
G29542 NA non-coding downstream 166 7798550 ~ 7800281 (-)
G29544 NA non-coding downstream 20380 7775273 ~ 7780067 (-)
G29551 NA non-coding downstream 39427 7759658 ~ 7761020 (-)
G29598 NA non-coding downstream 134453 7665757 ~ 7665994 (-)
G29575 NA non-coding downstream 246114 7552532 ~ 7554333 (-)
G29552 NA non-coding upstream 205 7800957 ~ 7804228 (-)
G29608 NA non-coding upstream 21090 7821842 ~ 7822063 (-)
G29610 NA non-coding upstream 34064 7834816 ~ 7836818 (-)
G29562 NA non-coding upstream 98606 7899358 ~ 7904097 (-)
G29388 NA other downstream 1168540 6631293 ~ 6631907 (-)
CI01000004_06539836_06541252 NA other downstream 1254875 6538904 ~ 6541252 (-)
CI01000004_05617072_05627369 NA other downstream 2172933 5616644 ~ 5628289 (-)
G27746 NA other downstream 2596723 5178227 ~ 5203724 (-)
G26788 NA other downstream 4524726 3267683 ~ 3275721 (-)
G29656 NA other upstream 163612 7964364 ~ 7965500 (-)
G29746 NA other upstream 553746 8354498 ~ 8358127 (-)
G30316 NA other upstream 1577185 9377937 ~ 9406921 (-)
G31203 NA other upstream 2945685 10746437 ~ 10750641 (-)
CI01000004_11407198_11412220 ADCYAP1B, ADCYAP1 other upstream 3606713 11406957 ~ 11412907 (-)

Expression


Co-expression Network