G28976


Basic Information

Item Value
gene id G28976
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 8938966 ~ 8939175 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU32775
AAGAAATGCGTTCATGTTCCAATTGCTCATATAATGTAAGTATAATGTTAAGTTCAAAGTATCTTATTTTGTGTTCTGCAGAGAAATAAAGAAGTCACACAGGTTTGGGAACAACATGAGTGTGAGTAAATGATGACAGAATTTATATTTTGGGTAGATTATCCCTCTAAACATATAGCCCGCTCAGAAATGTAATTCTGCGCAAATTTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU32775 True 210 lncRNA 0.47 1 8938966 8939175

Neighbor

gene id symbol gene type direction distance location
CI01000004_08875722_08877149 GM11353, RPS8A, RPS8 coding upstream 61459 8875722 ~ 8877507 (+)
CI01000004_08866163_08873681 HECTD3 coding upstream 65170 8866034 ~ 8873796 (+)
CI01000004_08823382_08844233 NA coding upstream 94621 8822749 ~ 8844345 (+)
CI01000004_08806791_08812203 NA coding upstream 126404 8806791 ~ 8812562 (+)
CI01000004_08746864_08765484 NA coding upstream 173061 8746484 ~ 8765905 (+)
CI01000004_08947119_08949558 NA coding downstream 7944 8947119 ~ 8949644 (+)
CI01000004_08976512_08980033 TTPA coding downstream 37079 8976254 ~ 8980984 (+)
CI01000004_08987501_08991239 NA coding downstream 47983 8987158 ~ 8991469 (+)
CI01000004_08996083_08997863 NA coding downstream 56908 8996083 ~ 8997863 (+)
CI01000004_09002274_09004879 IMPA1, IMPA1.3 coding downstream 62867 9002042 ~ 9005023 (+)
G28975 NA non-coding upstream 103 8936419 ~ 8938863 (+)
G28973 NA non-coding upstream 11476 8927145 ~ 8927490 (+)
G28971 NA non-coding upstream 12886 8925795 ~ 8926080 (+)
G28969 NA non-coding upstream 16026 8922722 ~ 8922940 (+)
G28968 NA non-coding upstream 16281 8922483 ~ 8922685 (+)
G28929 NA non-coding downstream 27840 8967015 ~ 8970631 (+)
G28989 NA non-coding downstream 32654 8971829 ~ 8973638 (+)
G28992 NA non-coding downstream 44315 8983490 ~ 8983703 (+)
G28994 NA non-coding downstream 78630 9017805 ~ 9021061 (+)
G28999 NA non-coding downstream 84877 9024052 ~ 9024252 (+)
G28859 NA other upstream 339363 8599235 ~ 8599603 (+)
CI01000004_08414451_08436256 NA other upstream 487739 8414316 ~ 8439933 (+)
CI01000004_07654234_07655677 MRPL34 other upstream 1282583 7654234 ~ 7656383 (+)
CI01000004_06571261_06572539 SEP15 other upstream 2364545 6570771 ~ 6572667 (+)
G28302 NA other upstream 2436879 6470028 ~ 6502087 (+)
G30797 NA other downstream 1558201 10497376 ~ 10497788 (+)
G31710 NA other downstream 2698076 11637251 ~ 11642400 (+)
CI01000004_11666900_11667179 NA other downstream 2725598 11666900 ~ 11667659 (+)
G31865 NA other downstream 3252955 12192130 ~ 12197418 (+)

Expression


Co-expression Network