G28999


Basic Information

Item Value
gene id G28999
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 9024052 ~ 9024252 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU32802
GCCAAAGTCACGTGATTTCAGCAGTTTGGCGGTTTGACACGCGATCCGAATCATGATTCGACACGCTGATTCATTACGCTCCGAATCTTCCTGAAGCAGTGTTTTGAAATCGGCCATCACTAAATAAGTCGTTATTTTGTTTTTTTGGCGCACCAAAAATTTTCTCGTCGCTTTATAATATTAATATTGAACCACTGTACT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU32802 True 201 lncRNA 0.34 1 9024052 9024252

Neighbor

gene id symbol gene type direction distance location
CI01000004_09002274_09004879 IMPA1, IMPA1.3 coding upstream 19029 9002042 ~ 9005023 (+)
CI01000004_08996083_08997863 NA coding upstream 26189 8996083 ~ 8997863 (+)
CI01000004_08987501_08991239 NA coding upstream 32583 8987158 ~ 8991469 (+)
CI01000004_08976512_08980033 TTPA coding upstream 43094 8976254 ~ 8980984 (+)
CI01000004_08947119_08949558 NA coding upstream 74408 8947119 ~ 8949644 (+)
CI01000004_09173580_09175411 NA coding downstream 147500 9171752 ~ 9175657 (+)
CI01000004_09185502_09218621 NA coding downstream 160583 9184835 ~ 9218642 (+)
CI01000004_09224465_09224950 NA coding downstream 198227 9222479 ~ 9224956 (+)
CI01000004_09340611_09363638 TESK2 coding downstream 315288 9339540 ~ 9364254 (+)
CI01000004_09371639_09375356 NA coding downstream 347387 9371639 ~ 9376005 (+)
G28994 NA non-coding upstream 2991 9017805 ~ 9021061 (+)
G28992 NA non-coding upstream 40349 8983490 ~ 8983703 (+)
G28989 NA non-coding upstream 50414 8971829 ~ 8973638 (+)
G28929 NA non-coding upstream 53421 8967015 ~ 8970631 (+)
G28976 NA non-coding upstream 84877 8938966 ~ 8939175 (+)
G29010 NA non-coding downstream 16832 9041084 ~ 9042246 (+)
G28980 NA non-coding downstream 184855 9209107 ~ 9211614 (+)
G30120 NA non-coding downstream 273004 9297256 ~ 9297656 (+)
G30129 NA non-coding downstream 283908 9308160 ~ 9309854 (+)
G30130 NA non-coding downstream 286107 9310359 ~ 9310561 (+)
G28859 NA other upstream 424449 8599235 ~ 8599603 (+)
CI01000004_08414451_08436256 NA other upstream 572825 8414316 ~ 8439933 (+)
CI01000004_07654234_07655677 MRPL34 other upstream 1367669 7654234 ~ 7656383 (+)
CI01000004_06571261_06572539 SEP15 other upstream 2449631 6570771 ~ 6572667 (+)
G30797 NA other downstream 1473124 10497376 ~ 10497788 (+)
G31710 NA other downstream 2612999 11637251 ~ 11642400 (+)
CI01000004_11666900_11667179 NA other downstream 2640521 11666900 ~ 11667659 (+)
G31865 NA other downstream 3167878 12192130 ~ 12197418 (+)
CI01000004_12646972_12652534 NA other downstream 3618502 12646838 ~ 12652570 (+)

Expression


Co-expression Network