G63941 (grid2,LOC107711862,LOC107669587,LOC107568412,LOC107594506)


Basic Information

Item Value
gene id G63941
gene name grid2,LOC107711862,LOC107669587,LOC107568412,LOC107594506
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056706.1
NCBI id CM032075.1
chromosome length 24299999
location 13997682 ~ 13997966 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU94644
CATAGTCAGTGTCGTAGAAGATAATGAACTTCTGCCAGGTGTACTCCATCACCACTTGGAAGATGACATCATTTAGGTAGACGGGAGGCCGGACGAAGAGAGTGTAGTCGTCTGGTTGGGCACGACTGGTGGGTGGGCAGCTAGAGCGAGGAGTGCCAGCGGGTGCCCTCTGGATGAAGAGGTGCGGGATGTGCATTGCGTCAGCTAAAGACTGCAGCGACCCCGCGGACATACAGCCGATAGAGCTGACCAAGGCTAAGATACCTCTGTTCATCAACTCGCAGG

Function

symbol description
grid2 Predicted to enable ionotropic glutamate receptor activity and transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential. Predicted to be involved in glutamatergic synaptic transmission and modulation of chemical synaptic transmission. Predicted to act upstream of or within ionotropic glutamate receptor signaling pathway. Predicted to be integral component of plasma membrane. Predicted to be active in postsynaptic membrane. Is expressed in brain and eye. Human ortholog(s) of this gene implicated in autosomal recessive spinocerebellar ataxia 18. Orthologous to human GRID2 (glutamate ionotropic receptor delta type subunit 2).

NR:

description
glutamate receptor ionotropic, delta-2 isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU94644 True 285 lncRNA 0.55 1 13997682 13997966

Neighbor

gene id symbol gene type direction distance location
cebpb cebpb,LOC107556312,LOC107669676,LOC107751442,LOC107594515,LOC107679873,LOC107711812 coding downstream 356200 13639945 ~ 13641482 (-)
adipor1b adipor1b,LOC107751445,LOC107679819,LOC107594512,LOC107711855 coding downstream 382344 13608854 ~ 13615338 (-)
LOC122351021 klhl12,LOC107679803,LOC107556315,LOC107711853,LOC107751446,LOC107594517 coding downstream 389405 13599250 ~ 13608277 (-)
tuba5 tuba8l,LOC108265838,LOC108425079,LOC107679810,LOC107711852,LOC107594520,LOC103031418 coding downstream 399835 13593701 ~ 13597847 (-)
kdm5bb LOC107751449,LOC107556320,LOC107711851 coding downstream 406506 13571079 ~ 13591176 (-)
LOC122350319 LOC107574771,LOC107751454,LOC107669655 coding upstream 175088 14173054 ~ 14175823 (-)
LOC122350320 prf1.5,LOC107751453,LOC107574770,LOC107594505,LOC107711865,LOC107679935 coding upstream 183566 14181532 ~ 14186141 (-)
mpeg1.1 mpeg1.1,LOC107724877,LOC107669601,LOC107602834,LOC107679909,LOC107724864,LOC107751428,LOC107602817 coding upstream 189463 14187429 ~ 14190244 (-)
LOC122349900 LOC107724883,LOC107580262,LOC107669607 coding upstream 195867 14193833 ~ 14194501 (-)
slc20a2 slc20a2,LOC107724891,LOC107669617,LOC107602837,LOC107594502,LOC107711867 coding upstream 227390 14225356 ~ 14259044 (-)
G63874 NA non-coding downstream 272208 13725069 ~ 13725474 (-)
G63873 NA non-coding downstream 273682 13723731 ~ 13724000 (-)
G63868 NA non-coding downstream 285281 13711155 ~ 13712401 (-)
G63867 NA non-coding downstream 297614 13699657 ~ 13700068 (-)
G63866 NA non-coding downstream 304460 13688178 ~ 13693222 (-)
G63942 NA non-coding upstream 8847 14006813 ~ 14007018 (-)
G63944 NA non-coding upstream 64531 14062497 ~ 14062740 (-)
G63962 grid2,LOC107669587,LOC107751431,LOC107711862,LOC107680191 non-coding upstream 101699 14099665 ~ 14100151 (-)
G63963 NA non-coding upstream 119764 14117730 ~ 14118002 (-)
G63956 grid2,LOC107669587,LOC107711862,LOC107751431,LOC107680191 non-coding upstream 130223 14128189 ~ 14128422 (-)
G63933 LOC107556304,LOC107751435,LOC107594508 other downstream 134432 13809428 ~ 13863250 (-)
mc3r mc3r,LOC107751459,LOC107669608,LOC107711834,LOC107680356 other downstream 277168 13716628 ~ 13720514 (-)
tafa3b si:ch211-254n4.3,fam19a3,LOC107711931,LOC107591764,LOC107562776,LOC107669582,LOC102289964,LOC104918365,LOC106582736,LOC105921069,LOC106517667,LOC108231490,LOC106937909 other downstream 751552 13185867 ~ 13246130 (-)
zmynd12 zymnd12,LOC107591768,LOC107711949,LOC107679700 other downstream 914310 12985654 ~ 13083372 (-)
foxp3a foxp3a,si:ch211-167b20.8,LOC107669635,LOC107731227,LOC107550508,LOC107711972,LOC107679368,LOC107591799,LOC107591800 other downstream 1493529 12489197 ~ 12504153 (-)
LOC122350784 zgc:162939,LOC107602843,LOC107674500,LOC107724903 other upstream 387634 14385600 ~ 14455243 (-)
slc20a1a slc20a1a,LOC107724894,LOC107711884,LOC107686402,LOC107667554,LOC107602858,LOC108440301 other upstream 725746 14723712 ~ 14731391 (-)
G64228 NA other upstream 781565 14779531 ~ 14781710 (-)
G64353 hmcn2,LOC107723245,LOC107659581,LOC107570300 other upstream 1285895 15283861 ~ 15284130 (-)
mvb12bb mvb12b,LOC107550570,LOC107753158,LOC107723228 other upstream 1651260 15649226 ~ 15700896 (-)

Expression


Co-expression Network