G64353 (hmcn2,LOC107723245,LOC107659581,LOC107570300)


Basic Information

Item Value
gene id G64353
gene name hmcn2,LOC107723245,LOC107659581,LOC107570300
gene type unknown
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056706.1
NCBI id CM032075.1
chromosome length 24299999
location 15283861 ~ 15284130 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU95181
TTTGCAGAATTAGTCTGATGTCATGGCTGGCTCTACCAGCATTGTTTCGGGCAGAGCAGGAGTAGATGCCTGCATCGCTGCGTTGAGTGGCAGTGACGTGCAGGGTGCCGTTAGAGAACAGTCTCAGGTGTGTGCCCTCCACCAGAGGCCTACGCTCCTTGTGCCACGTCACTTCTGGCTTTGGCTGACCGTCCGCTGTACAATCCAGACTGACCGGCTGGCCAAGAACTGCCGTGTACTCCAGACGAGGCACAGACAACACCGGAGGAA

Function

symbol description
hmcn2 Predicted to enable calcium ion binding activity. Acts upstream of or within several processes, including embryonic medial fin morphogenesis; mesenchymal cell migration; and skin morphogenesis. Is expressed in several structures, including axis; median fin fold; mesoderm; myotome; and trunk. Orthologous to human HMCN2 (hemicentin 2).

NR:

description
PREDICTED: hemicentin-1-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU95181 True 270 TUCP 0.57 1 15283861 15284130

Neighbor

gene id symbol gene type direction distance location
LOC122350063 rfesd,LOC107711828,LOC559859,LOC107580528 coding downstream 90925 15190586 ~ 15192936 (-)
si:dkey-164f24.2 LOC107667555,LOC107723247,LOC107570302,LOC107711905 coding downstream 95217 15180268 ~ 15188644 (-)
lipg LOC107738997,LOC107565987,LOC107711901,LOC107686385,LOC107599989,LOC107667539 coding downstream 118800 15160154 ~ 15165061 (-)
ipo11 ipo11 coding downstream 137434 15026090 ~ 15146427 (-)
rnf180a rnf180,LOC107667512,LOC107599991,LOC107711845,LOC106584965 coding downstream 285255 14993384 ~ 14998606 (-)
zgc:194839 LOC107659596,LOC107686408,LOC107723116,LOC107723115,LOC107575379,LOC107723246,LOC107723230,LOC107667514,LOC107570299 coding upstream 13495 15297625 ~ 15300723 (-)
ralgps1 ralgps1,LOC107727327,LOC107669254,LOC108412534,LOC107723240 coding upstream 23607 15307737 ~ 15390751 (-)
LOC122350755 zbtb34,LOC107723248,LOC107550586,LOC107727329,LOC107564041,LOC107727326 coding upstream 109219 15393349 ~ 15407170 (-)
lmx1bb lmx1bb,lmx1b,LOC107550585,LOC107723253,LOC107753135,LOC107564042 coding upstream 212363 15496493 ~ 15509195 (-)
LOC122350591 lmx1b,lmx1bb,LOC107550585,LOC107723253,LOC107564042,LOC107753135,LOC108434405 coding upstream 293978 15578108 ~ 15648322 (-)
G64352 hmcn2,LOC107570300,LOC107723245,LOC107659581,LOC101073929 non-coding downstream 4065 15279430 ~ 15279796 (-)
G64351 hmcn2,LOC107570300,LOC107723245,LOC107659581 non-coding downstream 23948 15259697 ~ 15259913 (-)
G64348 NA non-coding downstream 61321 15220832 ~ 15222540 (-)
G64336 NA non-coding downstream 105766 15176036 ~ 15178095 (-)
G64338 NA non-coding downstream 111256 15171944 ~ 15172605 (-)
G64354 NA non-coding upstream 1470 15285600 ~ 15285809 (-)
G64355 NA non-coding upstream 4781 15288911 ~ 15289192 (-)
G64356 hmcn2,LOC107570300,LOC107723245,LOC107659581 non-coding upstream 6139 15290269 ~ 15290491 (-)
G64357 hmcn2,LOC107659581,LOC107723245,LOC107580106 non-coding upstream 8215 15292345 ~ 15292985 (-)
G64359 hmcn2,LOC107570300,LOC107723245,LOC107659581 non-coding upstream 11220 15295350 ~ 15296221 (-)
G64228 NA other downstream 502151 14779531 ~ 14781710 (-)
slc20a1a slc20a1a,LOC107724894,LOC107711884,LOC107686402,LOC107667554,LOC107602858,LOC108440301 other downstream 552470 14723712 ~ 14731391 (-)
LOC122350784 zgc:162939,LOC107602843,LOC107674500,LOC107724903 other downstream 828618 14385600 ~ 14455243 (-)
G63933 LOC107556304,LOC107751435,LOC107594508 other downstream 1420611 13809428 ~ 13863250 (-)
mc3r mc3r,LOC107751459,LOC107669608,LOC107711834,LOC107680356 other downstream 1563347 13716628 ~ 13720514 (-)
mvb12bb mvb12b,LOC107550570,LOC107753158,LOC107723228 other upstream 365096 15649226 ~ 15700896 (-)
LOC122350093 NA other upstream 1123704 16407834 ~ 16409696 (-)
LOC122350945 drd2b,LOC107745132,LOC107705176,LOC107691748,LOC107664308,LOC107600777,LOC107556418,LOC108428674 other upstream 1762337 17046467 ~ 17096795 (-)
LOC122350953 NA other upstream 2036246 17320376 ~ 17401228 (-)
zgc:194007 NA other upstream 2075255 17359385 ~ 17361850 (-)

Expression


Co-expression Network