G64476 (gapvd1,LOC107669250,LOC107753155,LOC107555093,LOC107723237,LOC107550582)


Basic Information

Item Value
gene id G64476
gene name gapvd1,LOC107669250,LOC107753155,LOC107555093,LOC107723237,LOC107550582
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056706.1
NCBI id CM032075.1
chromosome length 24299999
location 16062879 ~ 16063753 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU95371
CCAAGAGCCTCGCCCACCCCTCTTCGCCCCTCACCTGGCGCAGAGTGACCTGGAGCATCCCAAGCAGAGGCACTCTTACCCTGAAAGGCTGGTCAGGAGCCGCAGCACAGATGTGGTGTCCGCTGGCCGCAGACCCAACAGTGATCCTGGACTGAACCGCAGGACCATGATGGAGGAGAGAGATCCAGCTGGGCTTATTCCACAGGACCCACCTCCTCTCCCAGCAAGGATTCACTCAAAGGAGAGTCTGAGGACAGGAAGGACAGTGATGATGAGAAGTCTGATAGGAACAGACCCTGGTGGAAGAAG

Function

symbol description
gapvd1 Predicted to enable guanyl-nucleotide exchange factor activity. Predicted to act upstream of or within endocytosis; regulation of GTPase activity; and signal transduction. Predicted to be located in membrane. Orthologous to human GAPVD1 (GTPase activating protein and VPS9 domains 1).

NR:

description
PREDICTED: LOW QUALITY PROTEIN: GTPase-activating protein and VPS9 domain-containing protein 1-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU95371 True 309 lncRNA 0.58 2 16062879 16063753

Neighbor

gene id symbol gene type direction distance location
LOC122351126 pbx3b,pbx3,LOC107550583,LOC107669256,LOC108434408,LOC107555108 coding downstream 70621 15967500 ~ 15992258 (-)
pbx3b pbx3b,pbx3,LOC107550583,LOC107669256,LOC107555108,LOC108434408 coding downstream 114096 15833965 ~ 15948783 (-)
LOC122350591 lmx1b,lmx1bb,LOC107550585,LOC107723253,LOC107564042,LOC107753135,LOC108434405 coding downstream 414557 15578108 ~ 15648322 (-)
lmx1bb lmx1bb,lmx1b,LOC107550585,LOC107723253,LOC107753135,LOC107564042 coding downstream 553684 15496493 ~ 15509195 (-)
LOC122350755 zbtb34,LOC107723248,LOC107550586,LOC107727329,LOC107564041,LOC107727326 coding downstream 655709 15393349 ~ 15407170 (-)
LOC122350711 LOC107550583,LOC107555108,LOC107669256 coding upstream 127334 16191087 ~ 16192344 (-)
LOC122350700 LOC107550582,LOC107723237 coding upstream 249751 16313504 ~ 16344494 (-)
setd1bb LOC107659604,LOC107550568,LOC107753154,LOC107669245,LOC107555095 coding upstream 290155 16353908 ~ 16363944 (-)
LOC122350716 LOC107550565,LOC107659586,LOC107723226,LOC107723224,LOC107550564 coding upstream 334823 16398576 ~ 16407398 (-)
LOC122350717 rimbp2,LOC107684511,LOC107753130,LOC108247306,LOC107081823 coding upstream 699544 16763297 ~ 16835560 (-)
LOC122351100 NA non-coding downstream 280992 15767668 ~ 15781887 (-)
G64409 NA non-coding downstream 411020 15651636 ~ 15651859 (-)
G64359 hmcn2,LOC107570300,LOC107723245,LOC107659581 non-coding downstream 766658 15295350 ~ 15296221 (-)
G64357 hmcn2,LOC107659581,LOC107723245,LOC107580106 non-coding downstream 769894 15292345 ~ 15292985 (-)
G64356 hmcn2,LOC107570300,LOC107723245,LOC107659581 non-coding downstream 772388 15290269 ~ 15290491 (-)
LOC122351008 NA non-coding upstream 15609 16079362 ~ 16094560 (-)
G64481 NA non-coding upstream 67858 16131611 ~ 16132812 (-)
LOC122350933 NA non-coding upstream 197784 16261537 ~ 16283392 (-)
G64502 LOC107723241,LOC107659605,LOC107550566 non-coding upstream 309568 16373321 ~ 16376597 (-)
G64503 LOC107723244 non-coding upstream 313361 16377114 ~ 16377369 (-)
mvb12bb mvb12b,LOC107550570,LOC107753158,LOC107723228 other downstream 361983 15649226 ~ 15700896 (-)
G64353 hmcn2,LOC107723245,LOC107659581,LOC107570300 other downstream 778749 15283861 ~ 15284130 (-)
G64228 NA other downstream 1281169 14779531 ~ 14781710 (-)
slc20a1a slc20a1a,LOC107724894,LOC107711884,LOC107686402,LOC107667554,LOC107602858,LOC108440301 other downstream 1331488 14723712 ~ 14731391 (-)
LOC122350784 zgc:162939,LOC107602843,LOC107674500,LOC107724903 other downstream 1607636 14385600 ~ 14455243 (-)
LOC122350093 NA other upstream 344081 16407834 ~ 16409696 (-)
LOC122350945 drd2b,LOC107745132,LOC107705176,LOC107691748,LOC107664308,LOC107600777,LOC107556418,LOC108428674 other upstream 982714 17046467 ~ 17096795 (-)
LOC122350953 NA other upstream 1256623 17320376 ~ 17401228 (-)
zgc:194007 NA other upstream 1295632 17359385 ~ 17361850 (-)
kcnip3a kcnip3a,LOC108440810,LOC107684506,LOC107553838,LOC107566017,LOC102307840,LOC108264878,LOC101482209,LOC103397788,LOC107753121,LOC107687962,LOC102210345,LOC108233759,LOC102228939,LOC102799407,LOC104951840,LOC102798027 other upstream 1537505 17601258 ~ 17645511 (-)

Expression


Co-expression Network