G66372 (prdm16)



Basic Information


Item Value
gene id G66372
gene name prdm16
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information


Item Value
chromosome id NC_056706.1
NCBI id CM032075.1
chromosome length 24299999
location 23383138 ~ 23383354 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence


>TU98204
GGAGCTAGCCGGGAGGTCTTTGGACACTGGTAATTGTATCTGAGGCTTAGACAAGACTGCTCAGACTTACAGATGAAAGGCTTGACACTGCTGTGTATGTGCTTGTGCTGCTTGAGGCCCGAGGAGGTGGCAAAGGTCTTGCCACACTCAGGGCAGGTGTGGGCTCGGGCACCGACGTGCTGAGAGCGGATGTGGCGCTGGAGGTTGCTGGGGTCTG

Function


symbol description
prdm16 Predicted to enable metal ion binding activity. Acts upstream of or within several processes, including cardiac muscle cell proliferation; embryonic cranial skeleton morphogenesis; and hematopoietic stem cell differentiation. Is expressed in several structures, including hindbrain neural rod; nervous system; pectoral fin bud; pronephric duct; and stomodeum. Orthologous to human PRDM16 (PR/SET domain 16).

NR:

description
PREDICTED: PR domain zinc finger protein 16 isoform X6

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU98204 True 217 lncRNA 0.58 1 23383138 23383354

Neighbor


gene id symbol gene type direction distance location
kiaa2013 si:dkeyp-104h9.5,kiaa2013,LOC107698843,LOC107678452 coding downstream 427243 22947856 ~ 22955895 (-)
LOC122350809 NA coding downstream 448015 22932133 ~ 22935123 (-)
tp73 tp73,LOC107698840 coding downstream 468969 22881023 ~ 22914169 (-)
rer1 rer1,LOC107698848,LOC107595758,LOC107748969,LOC107678415,LOC107710784,LOC107602473 coding downstream 503023 22875118 ~ 22880115 (-)
aak1a aak1a,LOC107678431,LOC107710782,LOC107698849,LOC107748970,LOC108426667,LOC107595757,LOC107602451 coding downstream 508240 22837109 ~ 22874898 (-)
clcn6 clcn6,LOC107710774 coding upstream 51517 23434871 ~ 23446449 (-)
LOC122351104 NA coding upstream 74257 23457611 ~ 23475050 (-)
pex10 pex10,LOC107748993,LOC107687115,LOC107691068,LOC107710779 coding upstream 93168 23476522 ~ 23480310 (-)
kank3 LOC107748960,LOC107687117,LOC107691060,LOC107595771,LOC107755278,LOC107602461 coding upstream 231848 23615202 ~ 23631174 (-)
si:dkeyp-100a1.6 NA coding upstream 256643 23639997 ~ 23644042 (-)
G66368 NA non-coding downstream 137628 23240972 ~ 23245510 (-)
LOC122350914 NA non-coding downstream 328546 23051882 ~ 23054592 (-)
G66339 NA non-coding downstream 396177 22985346 ~ 22986961 (-)
G66337 NA non-coding downstream 399973 22982711 ~ 22983165 (-)
G66235 LOC107703993,LOC107755595 non-coding downstream 678013 22699448 ~ 22705125 (-)
G66376 NA non-coding upstream 20363 23403717 ~ 23403925 (-)
G66378 NA non-coding upstream 26715 23410069 ~ 23410308 (-)
G66383 NA non-coding upstream 49456 23432810 ~ 23433742 (-)
G66444 NA non-coding upstream 210416 23593770 ~ 23625439 (-)
G66460 NA non-coding upstream 251778 23635132 ~ 23647620 (-)
tprg1l tprg1l,LOC107698845,LOC107710788,LOC107678419,LOC107748986 other downstream 451973 22926456 ~ 22931165 (-)
ddx51 ddx51 other downstream 547547 22829204 ~ 22835591 (-)
G66310 NA other downstream 586776 22795622 ~ 22796362 (-)
LOC122350259 LOC107678445,LOC107752560,LOC101882811,LOC107553112,LOC107757078,LOC108426735,LOC107703990,LOC107757081,LOC107553140,LOC107678447,LOC107752570 other downstream 636059 22727180 ~ 22747079 (-)
LOC122349902 nfu1,LOC107678441,LOC107553147,LOC107664472,LOC107570003 other downstream 742815 22637275 ~ 22640323 (-)
G66410 LOC107687112,LOC107595766 other upstream 193599 23576953 ~ 23583368 (-)
G66451 LOC107595774,LOC107733967,LOC107748958,LOC107693424 other upstream 274711 23658065 ~ 23663536 (-)
LOC122350426 NA other upstream 437146 23820500 ~ 23821991 (-)
LOC122350723 si:ch211-117c9.5,slc6a8,slc6a7,LOC107601348,LOC107697011,LOC107566000,LOC107673283,LOC107750894,LOC103370863,LOC105906418,LOC107601746,LOC107653404 other upstream 780613 24163967 ~ 24183176 (-)
G66606 rasl10a,LOC107672696,LOC107730711,LOC107744439,LOC107592305,LOC107599975 other upstream 871385 24254739 ~ 24268056 (-)

Expression



Co-expression Network